Rmu_sc0004579.1_g000002

calcium ion binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004579.1
OG0013165
Physical Location & Seq
Reverse (-)
7729 .. 8291
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004579.1_g000002.1.cds

Sequence Viewer

Length: 366 bp
atggaccatgataatgatggcaagctgaacttccaggagttttcggacaatgcttatgatatcttcaagaattatgttgaatttgagacaggcggagtacccacagcagaagataaatttgcagagcttgatgtgaacaaaaacaaattcatagaagctgaagaattgaaacccatactgcattatctttacccaggagaactaacctatgctacctatttcacaagttttctaattcatgaggctgatgataacaaagatgaaaaattaacgttgcaagagatgctgcatcacgaagatattttctacaacacagtctatgagagcagcaatgacgataaccatgatgatcacgacgaattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EF-hand_5 EF-hand_7 EF-hand_8

Protein Analysis

121

Amino Acids

14.31

Weight (kDa)

4.22

Isoelectric Point (pI)

40.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013165)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G27790 AT4G27790
fragaria_vesca FvH4_7g32060
malus_domestica MD01G1223500.v1.1 MD07G1294200.v1.1
prunus_persica Prupe.2G314000_v2.0.a1
pyrus_communis pycom07g26700
rosa_chinensis RchiOBHm_Chr1g0381671
rosa_laevigata RLG00000026216
rosa_multiflora Rmu_sc0004579.1_g000002 Rmu_sc0004579.1_g000003
rosa_roxburghii Rroxscaffold_4G00278530
rosa_rugosa Rorug01G0430300
rosa_samantha Rh1AG453600 Rh1BG410800 Rh1CG425200 Rh1DG442500
rosa_wichuraiana Rw1G039570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AclI AACGTT 1 cut(s) 272
AcsI RAATTY 4 cut(s) 80, 116, 146, 359
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 3 cut(s) 67, 80, 169
AjnI CCWGG 2 cut(s) 33, 193
AluBI AGCT 3 cut(s) 25, 127, 158
AluI AGCT 3 cut(s) 25, 127, 158
Alw26I GTCTC 1 cut(s) 80
ApeKI GCWGC 2 cut(s) 286, 327
ApoI RAATTY 4 cut(s) 80, 116, 146, 359
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BbvI GCAGC 2 cut(s) 273, 339
BccI CCATC 1 cut(s) 11
BciT130I CCWGG 2 cut(s) 35, 195
BclI TGATCA 1 cut(s) 349
BcoDI GTCTC 1 cut(s) 80
BisI GCNGC 2 cut(s) 287, 328
BlsI GCNGC 2 cut(s) 288, 329
Bme1390I CCNGG 2 cut(s) 35, 195
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 2 cut(s) 35, 195
BmsI GCATC 2 cut(s) 273, 298
BsaJI CCNNGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 337
BseBI CCWGG 2 cut(s) 35, 195
BseDI CCNNGG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 337
BseXI GCAGC 2 cut(s) 273, 339
BsmAI GTCTC 1 cut(s) 80
Bsp143I GATC 1 cut(s) 349
BspACI CCGC 1 cut(s) 93
BspHI TCATGA 1 cut(s) 238
BsrDI GCAATG 1 cut(s) 337
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 1 cut(s) 349
Bst2UI CCWGG 2 cut(s) 35, 195
Bst4CI ACNGT 1 cut(s) 316
BstAPI GCANNNNNTGC 1 cut(s) 283
BstC8I GCNNGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 352
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 1 cut(s) 349
BstMWI GCNNNNNNNGC 1 cut(s) 283
BstNI CCWGG 2 cut(s) 35, 195
BstSCI CCNGG 2 cut(s) 33, 193
BstV1I GCAGC 2 cut(s) 273, 339
Cac8I GCNNGC 1 cut(s) 23
CciI TCATGA 1 cut(s) 238
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 98
CviAII CATG 3 cut(s) 8, 239, 344
CviJI RGCY 4 cut(s) 25, 127, 158, 245
CviKI_1 RGCY 4 cut(s) 25, 127, 158, 245
CviQI GTAC 1 cut(s) 98
DpnI GATC 1 cut(s) 351
DpnII GATC 1 cut(s) 349
EciI GGCGGA 1 cut(s) 108
Eco32I GATATC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 180
EcoRI GAATTC 1 cut(s) 359
EcoRII CCWGG 2 cut(s) 33, 193
EcoRV GATATC 1 cut(s) 61
FaeI CATG 3 cut(s) 11, 242, 347
FaiI YATR 9 cut(s) 9, 57, 75, 152, 176, 210, 240, 321, 345
FalI AAGNNNNNCTT 2 cut(s) 14, 46
FatI CATG 3 cut(s) 7, 238, 343
FbaI TGATCA 1 cut(s) 349
Fnu4HI GCNGC 2 cut(s) 287, 328
Fsp4HI GCNGC 2 cut(s) 287, 328
GluI GCNGC 2 cut(s) 287, 328
Hin1II CATG 3 cut(s) 11, 242, 347
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 4 cut(s) 67, 239, 293, 353
Hpy8I GTNNAC 1 cut(s) 136
Hpy99I CGWCG 1 cut(s) 359
HpyCH4III ACNGT 1 cut(s) 316
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 4 cut(s) 122, 181, 277, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 283
HpySE526I ACGT 1 cut(s) 272
Hsp92II CATG 3 cut(s) 11, 242, 347
Ksp22I TGATCA 1 cut(s) 349
Kzo9I GATC 1 cut(s) 349
LpnPI CCDG 5 cut(s) 20, 47, 75, 180, 207
Lsp1109I GCAGC 2 cut(s) 273, 339
LweI GCATC 2 cut(s) 273, 298
MaeII ACGT 1 cut(s) 272
MalI GATC 1 cut(s) 351
MboI GATC 1 cut(s) 349
MboII GAAGA 4 cut(s) 55, 122, 173, 308
MluCI AATT 8 cut(s) 70, 80, 116, 146, 164, 234, 266, 359
MnlI CCTC 1 cut(s) 235
MseI TTAA 1 cut(s) 269
MslI CAYNNNNRTG 1 cut(s) 12
MspR9I CCNGG 2 cut(s) 35, 195
MvaI CCWGG 2 cut(s) 35, 195
MwoI GCNNNNNNNGC 1 cut(s) 283
NdeII GATC 1 cut(s) 349
NlaIII CATG 3 cut(s) 11, 242, 347
PagI TCATGA 1 cut(s) 238
PfoI TCCNGGA 1 cut(s) 33
PkrI GCNGC 2 cut(s) 288, 329
Psp1406I AACGTT 1 cut(s) 272
Psp6I CCWGG 2 cut(s) 33, 193
PspGI CCWGG 2 cut(s) 33, 193
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 12
SaqAI TTAA 1 cut(s) 269
SatI GCNGC 2 cut(s) 287, 328
Sau3AI GATC 1 cut(s) 349
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 2 cut(s) 35, 195
SetI ASST 6 cut(s) 27, 129, 160, 209, 218, 275
SfaNI GCATC 2 cut(s) 273, 298
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 12
Sse9I AATT 8 cut(s) 70, 80, 116, 146, 164, 234, 266, 359
SsiI CCGC 1 cut(s) 93
StyD4I CCNGG 2 cut(s) 33, 193
TaaI ACNGT 1 cut(s) 316
TaiI ACGT 1 cut(s) 275
TasI AATT 8 cut(s) 70, 80, 116, 146, 164, 234, 266, 359
Tru1I TTAA 1 cut(s) 269
Tru9I TTAA 1 cut(s) 269
TseI GCWGC 2 cut(s) 286, 327
TspDTI ATGAA 3 cut(s) 139, 227, 276
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 4 cut(s) 80, 116, 146, 359
XcmI CCANNNNNNNNNTGG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.