Rmu_sc0004579.1_g000003

calcium ion binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004579.1
Physical Location & Seq
Reverse (-)
8553 .. 9448
896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004579.1_g000003.1.cds

Sequence Viewer

Length: 711 bp
atggcgaaggcggtggtctatcttctattcgccaccacccttattgctcttatagtcctctctcccttcaagccacggtgccacaacgtccatggcctgcaccgccgccttggcttcaccggccacgtccccattttcgatcctcttgtttcgaagatggaatggtacgtggaggaaaagggattaggagaccaaaacattactctagatacggaacacgacttggttattgccaatgatgttgaggaagcacaggaatatttgagcgaggcgggaacgttgaatataaccatgaggctggtgagtatcttccctttgttggatgtggcacccgaagatggattcgttagctacaatgagctgaagcattggattgtggcacaagccgtggaaagaatgattcataggacacagaatgaaatggcatcccatgatagagatggagatcgagccatttctttcagggagtacctgccacaattttccatcgaggatattgacttaagttcttgtattgttattggggaccaaatgaagcagaatatgtatgcacatatgttccattttttgacagccattgatgatgttaatgataatgaaacagatagaaatgatatggagcatggacaagctggatggtggaagcagcaatttgataacgcagatgctgataggaatggtttacttaccttcaatgaacttaaagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

236

Amino Acids

27.09

Weight (kDa)

4.77

Isoelectric Point (pI)

35.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013165)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 480
AccB1I GGYRCC 2 cut(s) 78, 328
AciI CCGC 4 cut(s) 11, 103, 106, 272
AclI AACGTT 1 cut(s) 278
AclWI GGATC 1 cut(s) 134
AcoI YGGCCR 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 383
AfaI GTAC 2 cut(s) 167, 470
AfiI CCNNNNNNNGG 2 cut(s) 319, 338
AflII CTTAAG 1 cut(s) 502
AgsI TTSAA 3 cut(s) 70, 283, 694
AjiI CACGTC 1 cut(s) 127
AluBI AGCT 3 cut(s) 351, 361, 632
AluI AGCT 3 cut(s) 351, 361, 632
Alw26I GTCTC 1 cut(s) 183
AlwI GGATC 1 cut(s) 134
AlwNI CAGNNNCTG 1 cut(s) 668
AoxI GGCC 2 cut(s) 94, 121
ApeKI GCWGC 1 cut(s) 646
AspS9I GGNCC 1 cut(s) 526
AsuHPI GGTGA 2 cut(s) 109, 313
AsuII TTCGAA 1 cut(s) 152
AvaII GGWCC 1 cut(s) 526
BanI GGYRCC 2 cut(s) 78, 328
BbvI GCAGC 1 cut(s) 658
BccI CCATC 5 cut(s) 151, 332, 434, 494, 630
BceAI ACGGC 1 cut(s) 371
BcoDI GTCTC 1 cut(s) 183
BfaI CTAG 1 cut(s) 206
BfrI CTTAAG 1 cut(s) 502
BfuAI ACCTGC 1 cut(s) 480
BglI GCCNNNNNGGC 1 cut(s) 111
BisI GCNGC 2 cut(s) 106, 647
BlsI GCNGC 2 cut(s) 107, 648
Bme18I GGWCC 1 cut(s) 526
BmgBI CACGTC 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 526
BmiI GGNNCC 3 cut(s) 80, 330, 527
BmsI GCATC 2 cut(s) 434, 655
Bpu14I TTCGAA 1 cut(s) 152
BsaAI YACGTR 1 cut(s) 169
BsaBI GATNNNNATC 1 cut(s) 444
BsaI GGTCTC 1 cut(s) 183
BsaJI CCNNGG 4 cut(s) 74, 91, 109, 387
Bsc4I CCNNNNNNNGG 2 cut(s) 319, 338
Bse118I RCCGGY 1 cut(s) 119
Bse8I GATNNNNATC 1 cut(s) 444
BseDI CCNNGG 4 cut(s) 74, 91, 109, 387
BseGI GGATG 3 cut(s) 328, 425, 641
BseJI GATNNNNATC 1 cut(s) 444
BseLI CCNNNNNNNGG 2 cut(s) 319, 338
BseXI GCAGC 1 cut(s) 658
BsgI GTGCAG 1 cut(s) 83
BshFI GGCC 2 cut(s) 96, 123
BshNI GGYRCC 2 cut(s) 78, 328
BsiSI CCGG 1 cut(s) 120
BslFI GGGAC 2 cut(s) 113, 539
BslI CCNNNNNNNGG 2 cut(s) 319, 338
BsmAI GTCTC 1 cut(s) 183
BsmFI GGGAC 2 cut(s) 113, 539
BsnI GGCC 2 cut(s) 96, 123
Bso31I GGTCTC 1 cut(s) 183
Bsp119I TTCGAA 1 cut(s) 152
Bsp143I GATC 2 cut(s) 139, 445
Bsp19I CCATGG 1 cut(s) 91
BspACI CCGC 4 cut(s) 11, 103, 106, 272
BspANI GGCC 2 cut(s) 96, 123
BspLI GGNNCC 3 cut(s) 80, 330, 527
BspMI ACCTGC 1 cut(s) 480
BspPI GGATC 1 cut(s) 134
BspT104I TTCGAA 1 cut(s) 152
BspT107I GGYRCC 2 cut(s) 78, 328
BspTI CTTAAG 1 cut(s) 502
BspTNI GGTCTC 1 cut(s) 183
BsrFI RCCGGY 1 cut(s) 119
BssAI RCCGGY 1 cut(s) 119
BssECI CCNNGG 4 cut(s) 74, 91, 109, 387
BssMI GATC 2 cut(s) 139, 445
BssT1I CCWWGG 2 cut(s) 91, 109
Bst4CI ACNGT 1 cut(s) 78
BstAFI CTTAAG 1 cut(s) 502
BstBAI YACGTR 1 cut(s) 169
BstBI TTCGAA 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 98
BstDSI CCRYGG 3 cut(s) 74, 91, 387
BstF5I GGATG 3 cut(s) 328, 425, 641
BstKTI GATC 2 cut(s) 142, 448
BstMAI GTCTC 1 cut(s) 183
BstMBI GATC 2 cut(s) 139, 445
BstMWI GCNNNNNNNGC 3 cut(s) 102, 111, 120
BstV1I GCAGC 1 cut(s) 658
BstXI CCANNNNNNTGG 1 cut(s) 298
BsuRI GGCC 2 cut(s) 96, 123
BtgI CCRYGG 3 cut(s) 74, 91, 387
BtrI CACGTC 1 cut(s) 127
BtsCI GGATG 3 cut(s) 328, 425, 641
BveI ACCTGC 1 cut(s) 480
Cac8I GCNNGC 1 cut(s) 98
CaiI CAGNNNCTG 1 cut(s) 668
Cfr10I RCCGGY 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 526
Csp6I GTAC 2 cut(s) 166, 469
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 4 cut(s) 92, 292, 431, 623
CviQI GTAC 2 cut(s) 166, 469
DpnI GATC 2 cut(s) 141, 447
DpnII GATC 2 cut(s) 139, 445
EaeI YGGCCR 1 cut(s) 121
Eco130I CCWWGG 2 cut(s) 91, 109
Eco31I GGTCTC 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 526
Eco57I CTGAAG 1 cut(s) 383
EcoT14I CCWWGG 2 cut(s) 91, 109
ErhI CCWWGG 2 cut(s) 91, 109
FaeI CATG 4 cut(s) 95, 295, 434, 626
FaqI GGGAC 2 cut(s) 113, 539
FatI CATG 4 cut(s) 91, 291, 430, 622
FauI CCCGC 1 cut(s) 265
FauNDI CATATG 1 cut(s) 555
Fnu4HI GCNGC 2 cut(s) 106, 647
FokI GGATG 3 cut(s) 335, 412, 648
Fsp4HI GCNGC 2 cut(s) 106, 647
FspBI CTAG 1 cut(s) 206
GluI GCNGC 2 cut(s) 106, 647
HaeIII GGCC 2 cut(s) 96, 123
HapII CCGG 1 cut(s) 120
Hin1II CATG 4 cut(s) 95, 295, 434, 626
HinfI GANTC 2 cut(s) 342, 400
HpaII CCGG 1 cut(s) 120
HphI GGTGA 2 cut(s) 109, 313
Hpy166II GTNNAC 1 cut(s) 683
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 1 cut(s) 683
HpyAV CCTTC 2 cut(s) 76, 700
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4IV ACGT 4 cut(s) 87, 126, 168, 278
HpyCH4V TGCA 2 cut(s) 100, 551
HpyF10VI GCNNNNNNNGC 3 cut(s) 102, 111, 120
HpySE526I ACGT 4 cut(s) 87, 126, 168, 278
Hsp92II CATG 4 cut(s) 95, 295, 434, 626
Kzo9I GATC 2 cut(s) 139, 445
LmnI GCTCC 1 cut(s) 619
LpnPI CCDG 7 cut(s) 110, 133, 239, 284, 448, 485, 618
Lsp1109I GCAGC 1 cut(s) 658
LweI GCATC 2 cut(s) 434, 655
MaeI CTAG 1 cut(s) 206
MaeII ACGT 4 cut(s) 87, 126, 168, 278
MalI GATC 2 cut(s) 141, 447
MboI GATC 2 cut(s) 139, 445
MboII GAAGA 4 cut(s) 14, 166, 301, 347
MluCI AATT 2 cut(s) 479, 650
MmeI TCCRAC 1 cut(s) 300
MnlI CCTC 7 cut(s) 68, 153, 166, 238, 262, 288, 484
MseI TTAA 3 cut(s) 503, 588, 702
MspCI CTTAAG 1 cut(s) 502
MspI CCGG 1 cut(s) 120
MwoI GCNNNNNNNGC 3 cut(s) 102, 111, 120
NcoI CCATGG 1 cut(s) 91
NdeI CATATG 1 cut(s) 555
NdeII GATC 2 cut(s) 139, 445
NlaIII CATG 4 cut(s) 95, 295, 434, 626
NlaIV GGNNCC 3 cut(s) 80, 330, 527
NspV TTCGAA 1 cut(s) 152
PfeI GAWTC 2 cut(s) 342, 400
PkrI GCNGC 2 cut(s) 107, 648
Ppu21I YACGTR 1 cut(s) 169
Psp1406I AACGTT 1 cut(s) 278
PspN4I GGNNCC 3 cut(s) 80, 330, 527
PspPI GGNCC 1 cut(s) 526
PstNI CAGNNNCTG 1 cut(s) 668
RsaI GTAC 2 cut(s) 167, 470
RsaNI GTAC 2 cut(s) 166, 469
SaqAI TTAA 3 cut(s) 503, 588, 702
SatI GCNGC 2 cut(s) 106, 647
Sau3AI GATC 2 cut(s) 139, 445
Sau96I GGNCC 1 cut(s) 526
SetI ASST 9 cut(s) 90, 129, 171, 281, 353, 363, 474, 634, 692
SfaNI GCATC 2 cut(s) 434, 655
SfuI TTCGAA 1 cut(s) 152
SinI GGWCC 1 cut(s) 526
SmlI CTYRAG 1 cut(s) 502
SmoI CTYRAG 1 cut(s) 502
Sse9I AATT 2 cut(s) 479, 650
SsiI CCGC 4 cut(s) 11, 103, 106, 272
SspI AATATT 1 cut(s) 260
SspMI CTAG 1 cut(s) 206
StyI CCWWGG 2 cut(s) 91, 109
TaaI ACNGT 1 cut(s) 78
TaiI ACGT 4 cut(s) 90, 129, 171, 281
TaqI TCGA 4 cut(s) 138, 152, 448, 489
TasI AATT 2 cut(s) 479, 650
TauI GCSGC 1 cut(s) 108
TfiI GAWTC 2 cut(s) 342, 400
Tru1I TTAA 3 cut(s) 503, 588, 702
Tru9I TTAA 3 cut(s) 503, 588, 702
TseI GCWGC 1 cut(s) 646
TspDTI ATGAA 5 cut(s) 392, 432, 548, 612, 711
TspGWI ACGGA 1 cut(s) 227
Vha464I CTTAAG 1 cut(s) 502
VpaK11BI GGWCC 1 cut(s) 526
XbaI TCTAGA 1 cut(s) 205
XcmI CCANNNNNNNNNTGG 2 cut(s) 89, 437
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.