Rmu_sc0004593.1_g000007

Plant protein of unknown function (DUF936)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004593.1
Physical Location & Seq
Forward (+)
48677 .. 48970
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004593.1_g000007.1.cds

Sequence Viewer

Length: 294 bp
atggtggagacatcagagggtcctgtccaagccgatgatcatgcaggaagcaatagtttgaaatcaagggagtcctccgatgctaaagaagaaacctcgagacaaaagattgttattaaagaggaaaaggcagctattgcatctaggtatatgcaaggtttttcgacattaatttcaaaagctaactcacaagattctagtggaggtgggaagcacaatgataatgagagtggtggtaagaagcaggttggcatgataaaaggcaaacagcaagagcttaatggtcaggtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.35

Weight (kDa)

6.73

Isoelectric Point (pI)

47.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 235
AgsI TTSAA 2 cut(s) 61, 177
AluBI AGCT 3 cut(s) 134, 182, 277
AluI AGCT 3 cut(s) 134, 182, 277
Alw26I GTCTC 2 cut(s) 2, 94
Ama87I CYCGRG 1 cut(s) 97
ApeKI GCWGC 1 cut(s) 131
AseI ATTAAT 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 20
AvaI CYCGRG 1 cut(s) 97
AvaII GGWCC 1 cut(s) 20
BbvI GCAGC 1 cut(s) 143
BcgI CGANNNNNNTGC 2 cut(s) 23, 57
BclI TGATCA 1 cut(s) 37
BcoDI GTCTC 2 cut(s) 2, 94
BfaI CTAG 2 cut(s) 144, 198
BfuAI ACCTGC 1 cut(s) 235
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 20
BmeT110I CYCGRG 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 21
BmsI GCATC 2 cut(s) 70, 149
BseXI GCAGC 1 cut(s) 143
BsiHKCI CYCGRG 1 cut(s) 97
BsmAI GTCTC 2 cut(s) 2, 94
BsoBI CYCGRG 1 cut(s) 97
Bsp143I GATC 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 21
BspMI ACCTGC 1 cut(s) 235
BssMI GATC 1 cut(s) 37
BstAPI GCANNNNNTGC 1 cut(s) 137
BstKTI GATC 1 cut(s) 40
BstMAI GTCTC 2 cut(s) 2, 94
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstV1I GCAGC 1 cut(s) 143
BveI ACCTGC 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 20
CviAII CATG 2 cut(s) 41, 253
CviJI RGCY 4 cut(s) 32, 134, 182, 277
CviKI_1 RGCY 4 cut(s) 32, 134, 182, 277
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eco47I GGWCC 1 cut(s) 20
Eco88I CYCGRG 1 cut(s) 97
EcoO109I RGGNCCY 1 cut(s) 20
FaeI CATG 2 cut(s) 44, 256
FaiI YATR 5 cut(s) 42, 150, 152, 254, 292
FatI CATG 2 cut(s) 40, 252
FbaI TGATCA 1 cut(s) 37
Fnu4HI GCNGC 1 cut(s) 132
Fsp4HI GCNGC 1 cut(s) 132
FspBI CTAG 2 cut(s) 144, 198
GluI GCNGC 1 cut(s) 132
Hin1II CATG 2 cut(s) 44, 256
HinfI GANTC 2 cut(s) 71, 194
Hpy188I TCNGA 2 cut(s) 16, 79
Hpy188III TCNNGA 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 44, 140, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 2 cut(s) 44, 256
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 4 cut(s) 30, 36, 230, 272
Lsp1109I GCAGC 1 cut(s) 143
LweI GCATC 2 cut(s) 70, 149
MaeI CTAG 2 cut(s) 144, 198
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 101
MluCI AATT 1 cut(s) 171
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 5 cut(s) 10, 85, 106, 115, 197
MseI TTAA 3 cut(s) 117, 170, 279
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 37
NlaIII CATG 2 cut(s) 44, 256
NlaIV GGNNCC 1 cut(s) 21
PaeR7I CTCGAG 1 cut(s) 97
PfeI GAWTC 1 cut(s) 194
PkrI GCNGC 1 cut(s) 133
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PpuMI RGGWCCY 1 cut(s) 20
PshBI ATTAAT 1 cut(s) 170
Psp5II RGGWCCY 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 20
PspPPI RGGWCCY 1 cut(s) 20
SaqAI TTAA 3 cut(s) 117, 170, 279
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 20
SchI GAGTC 1 cut(s) 80
SetI ASST 9 cut(s) 98, 136, 149, 160, 184, 208, 249, 279, 291
SfaNI GCATC 2 cut(s) 70, 149
Sfr274I CTCGAG 1 cut(s) 97
SinI GGWCC 1 cut(s) 20
SlaI CTCGAG 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 1 cut(s) 171
SspMI CTAG 2 cut(s) 144, 198
TaqI TCGA 2 cut(s) 98, 164
TasI AATT 1 cut(s) 171
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 3 cut(s) 117, 170, 279
Tru9I TTAA 3 cut(s) 117, 170, 279
TseI GCWGC 1 cut(s) 131
VpaK11BI GGWCC 1 cut(s) 20
VspI ATTAAT 1 cut(s) 170
XhoI CTCGAG 1 cut(s) 97
XspI CTAG 2 cut(s) 144, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.