Rh2AG481800

Plant protein of unknown function (DUF936)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
70249160 .. 70252437
3278 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG481800.1

Sequence Viewer

Length: 309 bp
ATGGTGGAGCCATCAGAGGGTCCAGTCCAAGCTGATGATCATGCAGGAAGCAATAGTTTGAAATCAAGGGAGTCCTCCGATGCTAAAGAAGAAACCTCGAGACAAAAGATTGTTATTAAAGAGGAAAAGGCAGCTATTGCATCTAGGTATATGCAAGGTTTTTCAACATTAAATTCAAAAGCTAACTCACAAGATTCTAGTGGAGGTGGGAAGCACAATGATAATGAGAGTGGTGGTAAGAAGCAGGTTGGCATGATAAAAGGCAAACAGCAAGAGCTTAATGGTCAGTGTTACAGGCATGCTCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.04

Weight (kDa)

8.73

Isoelectric Point (pI)

49.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 235
AcsI RAATTY 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 3 cut(s) 61, 165, 177
AluBI AGCT 4 cut(s) 32, 134, 182, 277
AluI AGCT 4 cut(s) 32, 134, 182, 277
Alw26I GTCTC 1 cut(s) 94
Ama87I CYCGRG 1 cut(s) 97
ApeKI GCWGC 1 cut(s) 131
ApoI RAATTY 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 20
AvaI CYCGRG 1 cut(s) 97
AvaII GGWCC 1 cut(s) 20
BbvI GCAGC 1 cut(s) 143
BccI CCATC 1 cut(s) 19
BclI TGATCA 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 94
BfaI CTAG 2 cut(s) 144, 198
BfuAI ACCTGC 1 cut(s) 235
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 20
BmeT110I CYCGRG 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 20
BmiI GGNNCC 2 cut(s) 9, 21
BmsI GCATC 2 cut(s) 70, 149
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 23
BseXI GCAGC 1 cut(s) 143
BsiHKCI CYCGRG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 17
BsmAI GTCTC 1 cut(s) 94
BsoBI CYCGRG 1 cut(s) 97
Bsp143I GATC 1 cut(s) 37
BspLI GGNNCC 2 cut(s) 9, 21
BspMI ACCTGC 1 cut(s) 235
BsrI ACTGG 1 cut(s) 23
BssMI GATC 1 cut(s) 37
BstAPI GCANNNNNTGC 1 cut(s) 137
BstC8I GCNNGC 1 cut(s) 300
BstKTI GATC 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 302
BstV1I GCAGC 1 cut(s) 143
BtsIMutI CAGTG 1 cut(s) 293
BveI ACCTGC 1 cut(s) 235
Cac8I GCNNGC 1 cut(s) 300
Cfr13I GGNCC 1 cut(s) 20
CviAII CATG 3 cut(s) 41, 253, 299
CviJI RGCY 5 cut(s) 10, 32, 134, 182, 277
CviKI_1 RGCY 5 cut(s) 10, 32, 134, 182, 277
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eco47I GGWCC 1 cut(s) 20
Eco88I CYCGRG 1 cut(s) 97
FaeI CATG 3 cut(s) 44, 256, 302
FaiI YATR 5 cut(s) 42, 150, 152, 254, 300
FatI CATG 3 cut(s) 40, 252, 298
FbaI TGATCA 1 cut(s) 37
Fnu4HI GCNGC 1 cut(s) 132
Fsp4HI GCNGC 1 cut(s) 132
FspBI CTAG 2 cut(s) 144, 198
GluI GCNGC 1 cut(s) 132
Hin1II CATG 3 cut(s) 44, 256, 302
HinfI GANTC 2 cut(s) 71, 194
Hpy188I TCNGA 2 cut(s) 16, 79
Hpy188III TCNNGA 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 44, 140, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 3 cut(s) 44, 256, 302
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 4 cut(s) 30, 36, 230, 280
Lsp1109I GCAGC 1 cut(s) 143
LweI GCATC 2 cut(s) 70, 149
MaeI CTAG 2 cut(s) 144, 198
MaeIII GTNAC 1 cut(s) 290
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 101
MluCI AATT 1 cut(s) 172
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 5 cut(s) 10, 85, 106, 115, 197
MseI TTAA 3 cut(s) 117, 170, 279
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 37
NlaIII CATG 3 cut(s) 44, 256, 302
NlaIV GGNNCC 2 cut(s) 9, 21
NspI RCATGY 1 cut(s) 302
PaeI GCATGC 1 cut(s) 302
PaeR7I CTCGAG 1 cut(s) 97
PfeI GAWTC 1 cut(s) 194
PkrI GCNGC 1 cut(s) 133
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PspN4I GGNNCC 2 cut(s) 9, 21
PspPI GGNCC 1 cut(s) 20
SaqAI TTAA 3 cut(s) 117, 170, 279
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 20
SchI GAGTC 1 cut(s) 80
SetI ASST 9 cut(s) 34, 98, 136, 149, 160, 184, 208, 249, 279
SfaNI GCATC 2 cut(s) 70, 149
Sfr274I CTCGAG 1 cut(s) 97
SinI GGWCC 1 cut(s) 20
SlaI CTCGAG 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
SphI GCATGC 1 cut(s) 302
Sse9I AATT 1 cut(s) 172
SspMI CTAG 2 cut(s) 144, 198
TaqI TCGA 2 cut(s) 98, 304
TasI AATT 1 cut(s) 172
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 3 cut(s) 117, 170, 279
Tru9I TTAA 3 cut(s) 117, 170, 279
TscAI CASTG 1 cut(s) 293
TseI GCWGC 1 cut(s) 131
TspRI CASTG 1 cut(s) 293
VpaK11BI GGWCC 1 cut(s) 20
XapI RAATTY 1 cut(s) 172
XceI RCATGY 1 cut(s) 302
XhoI CTCGAG 1 cut(s) 97
XspI CTAG 2 cut(s) 144, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.