Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005045.1

Orthogroup ID

OG0007983

Physical Location & Seq

Genomic Coordinates Reverse (-)

126503 .. 128654

Gene Structure 2152 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005045.1_g000041.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1410 bp

atgtcgtttcagaacaagggtttttggatggcaaagggtgcgggacatgaaaatgatcgagatgcaacttttggtagcccttcaagaattgaaccaaagcggtctcaccaatggtttgtagattctgctgaaccccagattttccccaacaaaaagcaagcagtacatattccaaacagcaaactgagcacggatatgcccaatgaaaatgtctcttgggagaatccttccagctttcagtcggttccccatcaatttattgaccggttatttggatcggatacagcaagctctgccaacttttcagacaggaacgtgtctcctgttggatcagatgattggagcacaagaacaaagggtattgatgaccagttcggagaagatgctgcggtaaatttgtccatatctcatgctattgaagatcctgaagtatgtcttggctttgctgggattaggaaaatcaaagtcaaccaggttaaggacagcgacaatggcatgcatgcatcaagggaacatggttctagcagggaatataacagtaacctgcccacaagtcaggcatttgataggacacacgaaaccagtttcatatcagcagggcaggcatatgataaggagcatggtaatgtcacactaatgggtcatgcctacaaccagggagctgcccatgttagacctttaggtcccaactatggcaagagggaagaaaatgtgatatcaatgggtgatggttacagtaaaggtaatgccaatatgatatcttttggcgggtttcctgacgaacaagatatgaacaccatgggcagggctgttgcaaactatgatcaattataccatcagtcttctgtacaaacatcagaaactgcgaatgagaaagaattggatgcaacaaatgtcaatgcagttgataatactgcttctgtagctaaatcaagaccagaatcagcttccaagagtaaaccagagatcaaaccaataaagaaacaagctccaaacagcttcccctctaatgttagaagcttgatttcaactggcatcttagatggcgttcctgtaaagtatgtctccatggcacgggaggaacttcgcggaattataaagggttccagctatctttgcggctgtcaatcatgtaactttaccaaggggctaaatgcttatgaatttgagcggcatgctggttgcaaaacaaaacatccaaacaatcacatatactttgacaatgggaagaccatctatcagatagtacaggaattaaggagcacccctgaaagcttgttattcgatacaatgcaaacagtctttggcgctccgatcaatcagaaagcttttctcagttggaaagaatcctttcaagcagcaactcgtgaacttcagcgcatttacggaaaggaggaactgaacttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Jas

Protein Analysis

469

Amino Acids

51.96

Weight (kDa)

6.22

Isoelectric Point (pI)

41.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007983)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G59830 AT5G59830 AT5G59830
fragaria_vesca	FvH4_3g35080 FvH4_3g35080
malus_domestica	MD03G1099200.v1.1 MD11G1113100.v1.1
prunus_persica	Prupe.6G083800_v2.0.a1 Prupe.6G083800_v2.0.a1 Prupe.6G083800_v2.0.a1 Prupe.6G083800_v2.0.a1
pyrus_communis	pycom03g08150 pycom11g09540
rosa_chinensis	RchiOBHm_Chr5g0063081
rosa_laevigata	RLG00000035602
rosa_multiflora	Rmu_sc0005045.1_g000041
rosa_roxburghii	Rroxscaffold_1G00017570
rosa_rugosa	Rorug05G0354100 Rorug05G0354200
rosa_samantha	Rh5AG414600 Rh5BG429500 Rh5CG452900 Rh5DG443000
rosa_wichuraiana	Rw5G038960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1097
AasI	GACNNNNNNGTC	1 cut(s)	681
Acc36I	ACCTGC	1 cut(s)	552
AccBSI	CCGCTC	1 cut(s)	1171
AccII	CGCG	1 cut(s)	1089
AciI	CCGC	7 cut(s)	41, 100, 389, 768, 1089, 1119, 1171
AclWI	GGATC	3 cut(s)	283, 337, 416
AcsI	RAATTY	2 cut(s)	394, 1163
AcuI	CTGAAG	2 cut(s)	447, 1358
AfaI	GTAC	3 cut(s)	165, 849, 1248
AfiI	CCNNNNNNNGG	4 cut(s)	478, 692, 804, 1074
AflIII	ACRYGT	1 cut(s)	315
AgeI	ACCGGT	1 cut(s)	264
AgsI	TTSAA	5 cut(s)	84, 92, 419, 1029, 1355
AjnI	CCWGG	2 cut(s)	471, 654
AjuI	GAANNNNNNNTTGG	2 cut(s)	420, 452
Alw21I	GWGCWC	3 cut(s)	191, 347, 1265
Alw26I	GTCTC	4 cut(s)	108, 217, 324, 1069
AlwI	GGATC	3 cut(s)	283, 337, 416
AlwNI	CAGNNNCTG	1 cut(s)	863
ApeKI	GCWGC	3 cut(s)	386, 662, 1358
ApoI	RAATTY	2 cut(s)	394, 1163
ArsI	GACNNNNNNTTYG	2 cut(s)	254, 286
AsiGI	ACCGGT	1 cut(s)	264
Asp700I	GAANNNNTTC	1 cut(s)	1350
AspLEI	GCGC	2 cut(s)	1310, 1380
AspS9I	GGNCC	1 cut(s)	683
AsuHPI	GGTGA	2 cut(s)	98, 737
AvaII	GGWCC	1 cut(s)	683
BauI	CACGAG	1 cut(s)	1365
BbsI	GAAGAC	2 cut(s)	834, 1235
Bbv12I	GWGCWC	3 cut(s)	191, 347, 1265
BbvI	GCAGC	3 cut(s)	373, 649, 1370
BccI	CCATC	6 cut(s)	22, 258, 722, 843, 1037, 1241
BciT130I	CCWGG	2 cut(s)	473, 656
BciVI	GTATCC	1 cut(s)	274
BclI	TGATCA	1 cut(s)	823
BcoDI	GTCTC	4 cut(s)	108, 217, 324, 1069
BfaI	CTAG	1 cut(s)	522
BfmI	CTRYAG	1 cut(s)	921
BfoI	RGCGCY	1 cut(s)	1311
BfuAI	ACCTGC	1 cut(s)	552
BfuI	GTATCC	1 cut(s)	274
BisI	GCNGC	5 cut(s)	387, 663, 1120, 1172, 1359
BlsI	GCNGC	5 cut(s)	388, 664, 1121, 1173, 1360
Bme1390I	CCNGG	2 cut(s)	473, 656
Bme18I	GGWCC	1 cut(s)	683
BmgT120I	GGNCC	1 cut(s)	683
BmiI	GGNNCC	3 cut(s)	246, 685, 1105
BmrFI	CCNGG	2 cut(s)	473, 656
BmsI	GCATC	5 cut(s)	52, 373, 512, 874, 1044
BpiI	GAAGAC	2 cut(s)	834, 1235
BsaI	GGTCTC	1 cut(s)	108
BsaJI	CCNNGG	4 cut(s)	655, 798, 1068, 1143
BsaWI	WCCGGW	1 cut(s)	264
Bsc4I	CCNNNNNNNGG	4 cut(s)	478, 692, 804, 1074
Bse118I	RCCGGY	1 cut(s)	264
Bse1I	ACTGG	3 cut(s)	370, 582, 1036
BseBI	CCWGG	2 cut(s)	473, 656
BseDI	CCNNGG	4 cut(s)	655, 798, 1068, 1143
BseGI	GGATG	3 cut(s)	33, 889, 1195
BseLI	CCNNNNNNNGG	4 cut(s)	478, 692, 804, 1074
BseMII	CTCAG	2 cut(s)	176, 1348
BseNI	ACTGG	3 cut(s)	370, 582, 1036
BseXI	GCAGC	3 cut(s)	373, 649, 1370
BseYI	CCCAGC	1 cut(s)	446
Bsh1236I	CGCG	1 cut(s)	1089
BshTI	ACCGGT	1 cut(s)	264
BsiHKAI	GWGCWC	3 cut(s)	191, 347, 1265
BsiSI	CCGG	1 cut(s)	265
BslFI	GGGAC	2 cut(s)	57, 669
BslI	CCNNNNNNNGG	4 cut(s)	478, 692, 804, 1074
BsmAI	GTCTC	4 cut(s)	108, 217, 324, 1069
BsmFI	GGGAC	2 cut(s)	57, 669
Bso31I	GGTCTC	1 cut(s)	108
Bsp1286I	GDGCHC	3 cut(s)	191, 347, 1265
Bsp1407I	TGTACA	1 cut(s)	847
Bsp143I	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
Bsp19I	CCATGG	2 cut(s)	798, 1068
BspACI	CCGC	7 cut(s)	41, 100, 389, 768, 1089, 1119, 1171
BspCNI	CTCAG	2 cut(s)	177, 1347
BspFNI	CGCG	1 cut(s)	1089
BspLI	GGNNCC	3 cut(s)	246, 685, 1105
BspMI	ACCTGC	1 cut(s)	552
BspPI	GGATC	3 cut(s)	283, 337, 416
BspTNI	GGTCTC	1 cut(s)	108
BsrBI	CCGCTC	1 cut(s)	1171
BsrFI	RCCGGY	1 cut(s)	264
BsrGI	TGTACA	1 cut(s)	847
BsrI	ACTGG	3 cut(s)	370, 582, 1036
BssAI	RCCGGY	1 cut(s)	264
BssECI	CCNNGG	4 cut(s)	655, 798, 1068, 1143
BssMI	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
BssSI	CACGAG	1 cut(s)	1365
BssT1I	CCWWGG	3 cut(s)	798, 1068, 1143
Bst2BI	CACGAG	1 cut(s)	1365
Bst2UI	CCWGG	2 cut(s)	473, 656
Bst4CI	ACNGT	3 cut(s)	539, 737, 1300
BstAPI	GCANNNNNTGC	2 cut(s)	38, 293
BstAUI	TGTACA	1 cut(s)	847
BstC8I	GCNNGC	6 cut(s)	159, 289, 497, 501, 603, 1176
BstDEI	CTNAG	3 cut(s)	185, 1039, 1334
BstDSI	CCRYGG	2 cut(s)	798, 1068
BstF5I	GGATG	3 cut(s)	33, 889, 1195
BstFNI	CGCG	1 cut(s)	1089
BstH2I	RGCGCY	1 cut(s)	1311
BstHHI	GCGC	2 cut(s)	1310, 1380
BstKTI	GATC	7 cut(s)	58, 278, 332, 424, 826, 969, 1317
BstMAI	GTCTC	4 cut(s)	108, 217, 324, 1069
BstMBI	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
BstMWI	GCNNNNNNNGC	7 cut(s)	38, 186, 293, 492, 602, 923, 1116
BstNI	CCWGG	2 cut(s)	473, 656
BstNSI	RCATGY	3 cut(s)	499, 503, 1178
BstSCI	CCNGG	2 cut(s)	471, 654
BstSFI	CTRYAG	1 cut(s)	921
BstUI	CGCG	1 cut(s)	1089
BstV1I	GCAGC	3 cut(s)	373, 649, 1370
BstV2I	GAAGAC	2 cut(s)	834, 1235
BstX2I	RGATCY	1 cut(s)	421
BstYI	RGATCY	1 cut(s)	421
BsuI	GTATCC	1 cut(s)	274
BtgI	CCRYGG	2 cut(s)	798, 1068
BtsCI	GGATG	3 cut(s)	33, 889, 1195
BveI	ACCTGC	1 cut(s)	552
Cac8I	GCNNGC	6 cut(s)	159, 289, 497, 501, 603, 1176
CaiI	CAGNNNCTG	1 cut(s)	863
CfoI	GCGC	2 cut(s)	1310, 1380
Cfr10I	RCCGGY	1 cut(s)	264
Cfr13I	GGNCC	1 cut(s)	683
CsiI	ACCWGGT	1 cut(s)	471
Csp6I	GTAC	3 cut(s)	164, 848, 1247
CspAI	ACCGGT	1 cut(s)	264
CviQI	GTAC	3 cut(s)	164, 848, 1247
DdeI	CTNAG	3 cut(s)	185, 1039, 1334
DpnI	GATC	7 cut(s)	57, 277, 331, 423, 825, 968, 1316
DpnII	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
DrdI	GACNNNNNNGTC	1 cut(s)	681
DseDI	GACNNNNNNGTC	1 cut(s)	681
Eco130I	CCWWGG	3 cut(s)	798, 1068, 1143
Eco31I	GGTCTC	1 cut(s)	108
Eco32I	GATATC	2 cut(s)	717, 759
Eco47I	GGWCC	1 cut(s)	683
Eco57I	CTGAAG	2 cut(s)	447, 1358
EcoO109I	RGGNCCY	1 cut(s)	683
EcoRII	CCWGG	2 cut(s)	471, 654
EcoRV	GATATC	2 cut(s)	717, 759
EcoT14I	CCWWGG	3 cut(s)	798, 1068, 1143
EcoT22I	ATGCAT	2 cut(s)	501, 505
ErhI	CCWWGG	3 cut(s)	798, 1068, 1143
FalI	AAGNNNNNCTT	2 cut(s)	420, 452
FaqI	GGGAC	2 cut(s)	57, 669
FauI	CCCGC	2 cut(s)	34, 761
FauNDI	CATATG	1 cut(s)	607
FbaI	TGATCA	1 cut(s)	823
Fnu4HI	GCNGC	5 cut(s)	387, 663, 1120, 1172, 1359
FokI	GGATG	3 cut(s)	40, 896, 1182
Fsp4HI	GCNGC	5 cut(s)	387, 663, 1120, 1172, 1359
FspBI	CTAG	1 cut(s)	522
GlaI	GCGC	2 cut(s)	1309, 1379
GluI	GCNGC	5 cut(s)	387, 663, 1120, 1172, 1359
GsaI	CCCAGC	1 cut(s)	450
HaeII	RGCGCY	1 cut(s)	1311
HapII	CCGG	1 cut(s)	265
HhaI	GCGC	2 cut(s)	1310, 1380
Hin6I	GCGC	2 cut(s)	1308, 1378
HinP1I	GCGC	2 cut(s)	1308, 1378
HincII	GTYRAC	1 cut(s)	469
HindII	GTYRAC	1 cut(s)	469
HindIII	AAGCTT	3 cut(s)	1018, 1273, 1326
HinfI	GANTC	4 cut(s)	122, 223, 941, 1346
HpaII	CCGG	1 cut(s)	265
HphI	GGTGA	2 cut(s)	98, 737
Hpy166II	GTNNAC	3 cut(s)	469, 959, 1370
Hpy188I	TCNGA	9 cut(s)	12, 280, 307, 334, 377, 859, 1242, 1314, 1323
Hpy188III	TCNNGA	6 cut(s)	59, 84, 425, 776, 933, 1367
Hpy8I	GTNNAC	3 cut(s)	469, 959, 1370
HpyAV	CCTTC	2 cut(s)	90, 237
HpyCH4III	ACNGT	3 cut(s)	539, 737, 1300
HpyCH4IV	ACGT	1 cut(s)	315
HpyCH4V	TGCA	8 cut(s)	65, 499, 503, 815, 887, 902, 1185, 1294
HpyF10VI	GCNNNNNNNGC	7 cut(s)	38, 186, 293, 492, 602, 923, 1116
HpyF3I	CTNAG	3 cut(s)	185, 1039, 1334
HpySE526I	ACGT	1 cut(s)	315
HspAI	GCGC	2 cut(s)	1308, 1378
Ksp22I	TGATCA	1 cut(s)	823
Kzo9I	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
LmnI	GCTCC	6 cut(s)	342, 616, 659, 994, 1260, 1315
Lsp1109I	GCAGC	3 cut(s)	373, 649, 1370
LweI	GCATC	5 cut(s)	52, 373, 512, 874, 1044
MabI	ACCWGGT	1 cut(s)	471
MaeI	CTAG	1 cut(s)	522
MaeII	ACGT	1 cut(s)	315
MaeIII	GTNAC	4 cut(s)	539, 628, 731, 1133
MalI	GATC	7 cut(s)	57, 277, 331, 423, 825, 968, 1316
MbiI	CCGCTC	1 cut(s)	1171
MboI	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
MboII	GAAGA	5 cut(s)	392, 431, 716, 834, 1240
MflI	RGATCY	1 cut(s)	421
MhlI	GDGCHC	3 cut(s)	191, 347, 1265
MluCI	AATT	8 cut(s)	87, 254, 394, 827, 878, 1092, 1163, 1253
MmeI	TCCRAC	2 cut(s)	307, 1319
MnlI	CCTC	4 cut(s)	693, 1015, 1072, 1387
Mph1103I	ATGCAT	2 cut(s)	501, 505
MroXI	GAANNNNTTC	1 cut(s)	1350
MseI	TTAA	2 cut(s)	477, 1256
MslI	CAYNNNNRTG	4 cut(s)	51, 194, 624, 635
MspI	CCGG	1 cut(s)	265
MspR9I	CCNGG	2 cut(s)	473, 656
MvaI	CCWGG	2 cut(s)	473, 656
MvnI	CGCG	1 cut(s)	1089
MwoI	GCNNNNNNNGC	7 cut(s)	38, 186, 293, 492, 602, 923, 1116
NcoI	CCATGG	2 cut(s)	798, 1068
NdeI	CATATG	1 cut(s)	607
NdeII	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
NlaIV	GGNNCC	3 cut(s)	246, 685, 1105
NmuCI	GTSAC	1 cut(s)	628
NsiI	ATGCAT	2 cut(s)	501, 505
NspI	RCATGY	3 cut(s)	499, 503, 1178
PaeI	GCATGC	3 cut(s)	499, 503, 1178
PdmI	GAANNNNTTC	1 cut(s)	1350
PfeI	GAWTC	4 cut(s)	122, 223, 941, 1346
PinAI	ACCGGT	1 cut(s)	264
PkrI	GCNGC	5 cut(s)	388, 664, 1121, 1173, 1360
PpuMI	RGGWCCY	1 cut(s)	683
PsiI	TTATAA	1 cut(s)	1097
Psp5II	RGGWCCY	1 cut(s)	683
Psp6I	CCWGG	2 cut(s)	471, 654
PspFI	CCCAGC	1 cut(s)	446
PspGI	CCWGG	2 cut(s)	471, 654
PspN4I	GGNNCC	3 cut(s)	246, 685, 1105
PspPI	GGNCC	1 cut(s)	683
PspPPI	RGGWCCY	1 cut(s)	683
PstNI	CAGNNNCTG	1 cut(s)	863
PsuI	RGATCY	1 cut(s)	421
RsaI	GTAC	3 cut(s)	165, 849, 1248
RsaNI	GTAC	3 cut(s)	164, 848, 1247
RseI	CAYNNNNRTG	4 cut(s)	51, 194, 624, 635
SaqAI	TTAA	2 cut(s)	477, 1256
SatI	GCNGC	5 cut(s)	387, 663, 1120, 1172, 1359
Sau3AI	GATC	7 cut(s)	55, 275, 329, 421, 823, 966, 1314
Sau96I	GGNCC	1 cut(s)	683
ScrFI	CCNGG	2 cut(s)	473, 656
SduI	GDGCHC	3 cut(s)	191, 347, 1265
SexAI	ACCWGGT	1 cut(s)	471
SfaNI	GCATC	5 cut(s)	52, 373, 512, 874, 1044
SfcI	CTRYAG	1 cut(s)	921
SinI	GGWCC	1 cut(s)	683
SmiMI	CAYNNNNRTG	4 cut(s)	51, 194, 624, 635
SphI	GCATGC	3 cut(s)	499, 503, 1178
Sse9I	AATT	8 cut(s)	87, 254, 394, 827, 878, 1092, 1163, 1253
SsiI	CCGC	7 cut(s)	41, 100, 389, 768, 1089, 1119, 1171
SspMI	CTAG	1 cut(s)	522
StyD4I	CCNGG	2 cut(s)	471, 654
StyI	CCWWGG	3 cut(s)	798, 1068, 1143
TaaI	ACNGT	3 cut(s)	539, 737, 1300
TaiI	ACGT	1 cut(s)	318
TaqI	TCGA	2 cut(s)	58, 1284
TasI	AATT	8 cut(s)	87, 254, 394, 827, 878, 1092, 1163, 1253
TatI	WGTACW	3 cut(s)	163, 847, 1246
TauI	GCSGC	2 cut(s)	1122, 1174
TfiI	GAWTC	4 cut(s)	122, 223, 941, 1346
Tru1I	TTAA	2 cut(s)	477, 1256
Tru9I	TTAA	2 cut(s)	477, 1256
TseFI	GTSAC	1 cut(s)	628
TseI	GCWGC	3 cut(s)	386, 662, 1358
Tsp45I	GTSAC	1 cut(s)	628
TspDTI	ATGAA	5 cut(s)	63, 219, 577, 806, 1176
TspGWI	ACGGA	2 cut(s)	206, 1401
VpaK11BI	GGWCC	1 cut(s)	683
XapI	RAATTY	2 cut(s)	394, 1163
XceI	RCATGY	3 cut(s)	499, 503, 1178
XmnI	GAANNNNTTC	1 cut(s)	1350
XspI	CTAG	1 cut(s)	522
Zsp2I	ATGCAT	2 cut(s)	501, 505

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.