Rmu_sc0005127.1_g000010

ATPase 8, plasma

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005127.1
OG0011636
Physical Location & Seq
Reverse (-)
62157 .. 66477
4321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005127.1_g000010.1.cds

Sequence Viewer

Length: 2838 bp
atggccaatatctccttagaggacgtgaaaaaggagaacgtcgaccttgagaaaatcccggtggaggaagtgttcgagcagctgaaatgctcgaaggaggggttgagctcagaggagggcacgaagaggatccaggttttcggcccgaataagctcgaggaaaagaaagagagcaaggttctcaagttcctcgggttcatgtggaatcccttatcatgggtgatggaggctgctgcaatcatggccattgttttggccaatggagggggaaagcctccggattggccagacttcgtcggtattgtggtgcttctgatcatcaactcaactatatcattcatcgaagagaacaatgccggcaacgctgctgcggctctgatggctagtctagcccccaagaccaaggtgttacgggatggaaaatggggtgagcaagaggcagaaattttggtaccaggggatgtgattagcatcaagttgggagatatagtcccagctgatgctcgtctcctggagggcgatcccttaaagattgaccaagctgctctcaccggtgaatccctaccggtcaccaggcaccccggggatgaggtcttctctggatctacatgcaagcagggcgagattgaggccgttgtaatcgcaactggagtccacactttctttggcaaggctgcacacttggtggatagcaccaaccaagttggtcacttccaaaaggtgttgacatccattggtaacttctgcatctgctccattggaattggaatggcgattgagatactggtgatgtaccccattcagcacagggcatatagagatggtattgacaatctgttggtgctcctgatcggaggtatccccattgccatgccaacggtcttatccgtgaccatggctattgggtctcaccgcttgtcacagcaaggtgccatcaccaagaggatgacagccattgaagaaatggcaggaatggatgtcctttgcagtgacaagaccggaaccctcaccctcaacaagcttaccgtcgacaagagtctgattgaggtgttccctaagaacatggacaaagacacagtggtcttgctctctgccagggcttccagggttgaaaaccaggacgcaattgatgcctcaattgttgggatgctaagtgaccccaaggaggcaagagcagggatcactgaggtacatttcctgcccttcaaccctgtcgagaagcgcacagcaatcacctacatcgatagcaatggcgactggcacagatgcagcaagggtgctcctgagcaaataattgacctatgtgcccttaagggagaagcgaggaagaaggcccatgaagtcattgacaactatgctaaccgtggtcttcgttcattgggagttgcacgacagacagtatcagagaagaccaaggaaagtgctggtgatgaatgggagtttgtgggtctattgcctctctttgaccctccaaggcatgacagtgctgagactatccgccgtgctcttgagcttggtgtcaatgttaagatgatcactggtgaccaactggccattggaaaagagactggtcgaaggcttggcatgggcaccaacatgtatccttcatctacccttcttggcgaaagcaaggacgagtccattgcttcaattcctgtggatgagctcattgaaaaggctgatggatttgctggagtcttccctgagcacaagtatgagattgttaagagactgcaggagaggaagcacatctgtggtatgaccggagatggtgtgaatgatgccccggctctcaagagagcagacattggcatcgcagtggatgatgcaactgatgcagccaggagtgcctcggacattgtactgactgagccaggactaagtgttattgtgagcgccgtcttgacaagcagagccatcttccagaggatgaagaattataccatttatgctgtttccatcacaatccgtattgtggtgggattcatgcttcttgctctcatatggaaatatgacttcccaccattcatggtcttggtcattgcagtcttgaacgacgggaccatcatgaccatctctaaggatagagtgaagccatctcctctgcctgactcctggaaactcaaggaaatcttcgccactggagttgtccttggttcctacatggctgtcatgactgtggtcttcttctggcttgcacacagcactctctttttctctaaaatatttggtgtgagacctcttgaggaccttcagcttaactcagctgtctacctccaagtgagcattctcagtcaagcactcatctttgtgacccgatcaaggagctggtcctttgttgaacgccctggtaccatgcttatggttgcctttcttgcagcgcagttggtggctaccctcattgccgtatattgtgactggggctttgccaaaatcaacggtatcggatggggatgggcaggcgctatctgggtctacagcattgtcacctatttccctctcgatatcttcaagttcctgatccgttttgcattgagtggccatgcctgggataatgttgtccagaacaagactgccttcacaacaaagaatgactatggaaagcctgagagagaggcacagtgggcatcggctcagcgtacactccatggtctccaggctcctccagaaatgttccatggaagccacggggatgatcaatccatggctgagcaggccaagaggcgagcagaagttgctaggctgagggagctccacaccttaaaggggcacgtcgaatctgtggtcaagctgaaggggctagacatcgacaccatccaacaacactacaccgtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

945

Amino Acids

103.65

Weight (kDa)

5.93

Isoelectric Point (pI)

32.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011636)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07560 AT3G42640
fragaria_vesca FvH4_1g01450 FvH4_1g01450
malus_domestica MD02G1011600.v1.1
prunus_persica Prupe.7G258000_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0086371
rosa_laevigata RLG00000015753
rosa_multiflora Rmu_co8318751.1_g000001 Rmu_sc0003572.1_g000001 Rmu_sc0005127.1_g000010
rosa_roxburghii Rroxscaffold_2G00154660
rosa_rugosa Rorug01G0466900 Rorug01G0467000
rosa_samantha Rh2AG017100 Rh2BG016900 Rh2CG017900 Rh2DG018600
rosa_wichuraiana Rw2G001450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1079
Acc65I GGTACC 2 cut(s) 451, 2351
AccB1I GGYRCC 5 cut(s) 451, 576, 929, 1589, 2351
AccI GTMKAC 4 cut(s) 42, 1029, 2271, 2475
AccIII TCCGGA 1 cut(s) 277
AciI CCGC 3 cut(s) 371, 913, 1498
AclWI GGATC 6 cut(s) 124, 137, 515, 610, 1187, 2515
AcoI YGGCCR 6 cut(s) 3, 243, 255, 284, 1551, 2539
AcsI RAATTY 1 cut(s) 444
AcuI CTGAAG 2 cut(s) 2237, 2813
AdeI CACNNNGTG 1 cut(s) 685
AfaI GTAC 6 cut(s) 453, 794, 1191, 1863, 2353, 2641
AfiI CCNNNNNNNGG 8 cut(s) 64, 216, 264, 1165, 1975, 2322, 2548, 2766
AflII CTTAAG 1 cut(s) 1310
AflIII ACRYGT 1 cut(s) 1596
AgeI ACCGGT 2 cut(s) 551, 565
AgsI TTSAA 8 cut(s) 959, 1112, 1207, 1650, 1673, 2053, 2342, 2512
AjiI CACGTC 2 cut(s) 25, 2773
AjuI GAANNNNNNNTTGG 2 cut(s) 2271, 2303
AleI CACNNNNGTG 1 cut(s) 1752
AloI GAACNNNNNNTCC 2 cut(s) 56, 88
Alw21I GWGCWC 7 cut(s) 110, 846, 1282, 1507, 1668, 1710, 2754
Alw26I GTCTC 7 cut(s) 512, 912, 1484, 1559, 1723, 2230, 2657
AlwI GGATC 6 cut(s) 124, 137, 515, 610, 1187, 2515
Ama87I CYCGRG 3 cut(s) 155, 191, 581
Aor13HI TCCGGA 1 cut(s) 277
ApoI RAATTY 1 cut(s) 444
ArsI GACNNNNNNTTYG 4 cut(s) 2408, 2440, 2769, 2801
AsiGI ACCGGT 2 cut(s) 551, 565
Asp718I GGTACC 2 cut(s) 451, 2351
AspLEI GCGC 4 cut(s) 1224, 1898, 2383, 2465
AspS9I GGNCC 5 cut(s) 143, 1333, 2061, 2248, 2331
AsuC2I CCSGG 4 cut(s) 59, 582, 583, 1787
AvaI CYCGRG 3 cut(s) 155, 191, 581
AvaII GGWCC 3 cut(s) 2061, 2248, 2331
BaeGI GKGCMC 4 cut(s) 122, 1309, 1592, 2772
BalI TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
BamHI GGATCC 1 cut(s) 129
BanI GGYRCC 5 cut(s) 451, 576, 929, 1589, 2351
BanII GRGCYC 3 cut(s) 110, 1668, 2754
BbsI GAAGAC 5 cut(s) 586, 1361, 1415, 1690, 2176
Bbv12I GWGCWC 7 cut(s) 110, 846, 1282, 1507, 1668, 1710, 2754
BbvCI CCTCAGC 1 cut(s) 2744
BceAI ACGGC 4 cut(s) 617, 1485, 1883, 2390
BcgI CGANNNNNNTGC 2 cut(s) 1625, 1659
BciVI GTATCC 2 cut(s) 869, 1611
BclI TGATCA 3 cut(s) 315, 1533, 2695
BcnI CCSGG 4 cut(s) 59, 582, 583, 1787
BcoDI GTCTC 7 cut(s) 512, 912, 1484, 1559, 1723, 2230, 2657
BfaI CTAG 5 cut(s) 384, 389, 2739, 2801, 2836
BfmI CTRYAG 2 cut(s) 1733, 2476
BfoI RGCGCY 2 cut(s) 1899, 2466
BfrI CTTAAG 1 cut(s) 1310
BfuI GTATCC 2 cut(s) 869, 1611
BlpI GCTNAGC 2 cut(s) 2634, 2709
Bme18I GGWCC 3 cut(s) 2061, 2248, 2331
BmeT110I CYCGRG 3 cut(s) 155, 191, 581
BmgBI CACGTC 2 cut(s) 25, 2773
BmgT120I GGNCC 5 cut(s) 143, 1333, 2061, 2248, 2331
BmrI ACTGGG 1 cut(s) 2428
BmuI ACTGGG 1 cut(s) 2428
BoxI GACNNNNGTC 2 cut(s) 1035, 2180
BpiI GAAGAC 5 cut(s) 586, 1361, 1415, 1690, 2176
BplI GAGNNNNNCTC 2 cut(s) 581, 613
BpmI CTGGAG 6 cut(s) 533, 669, 1713, 2163, 2639, 2649
Bpu10I CCTNAGC 3 cut(s) 1284, 1704, 2744
Bpu1102I GCTNAGC 2 cut(s) 2634, 2709
BpuEI CTTGAG 6 cut(s) 68, 167, 1529, 1778, 2108, 2264
BpuMI CCSGG 4 cut(s) 59, 582, 583, 1787
Bsa29I ATCGAT 1 cut(s) 1242
BsaBI GATNNNNATC 1 cut(s) 470
BsaI GGTCTC 3 cut(s) 912, 2230, 2657
BsaWI WCCGGW 5 cut(s) 277, 551, 565, 998, 1763
BsaXI ACNNNNNCTCC 6 cut(s) 56, 86, 474, 504, 1758, 1788
Bsc4I CCNNNNNNNGG 8 cut(s) 64, 216, 264, 1165, 1975, 2322, 2548, 2766
Bse118I RCCGGY 3 cut(s) 356, 551, 565
Bse1I ACTGG 8 cut(s) 652, 789, 1262, 1543, 1554, 1573, 2146, 2423
Bse3DI GCAATG 5 cut(s) 864, 1255, 1641, 2040, 2400
Bse8I GATNNNNATC 1 cut(s) 470
BseAI TCCGGA 1 cut(s) 277
BseCI ATCGAT 1 cut(s) 1242
BseJI GATNNNNATC 1 cut(s) 470
BseLI CCNNNNNNNGG 8 cut(s) 64, 216, 264, 1165, 1975, 2322, 2548, 2766
BseMI GCAATG 5 cut(s) 864, 1255, 1641, 2040, 2400
BseNI ACTGG 8 cut(s) 652, 789, 1262, 1543, 1554, 1573, 2146, 2423
BseRI GAGGAG 3 cut(s) 128, 2091, 2652
BseSI GKGCMC 4 cut(s) 122, 1309, 1592, 2772
BseYI CCCAGC 1 cut(s) 493
BsgI GTGCAG 1 cut(s) 660
BshNI GGYRCC 5 cut(s) 451, 576, 929, 1589, 2351
BshTI ACCGGT 2 cut(s) 551, 565
BshVI ATCGAT 1 cut(s) 1242
BsiHKAI GWGCWC 7 cut(s) 110, 846, 1282, 1507, 1668, 1710, 2754
BsiHKCI CYCGRG 3 cut(s) 155, 191, 581
BsiSI CCGG 9 cut(s) 59, 278, 357, 552, 566, 582, 999, 1764, 1787
BslFI GGGAC 2 cut(s) 476, 2074
BslI CCNNNNNNNGG 8 cut(s) 64, 216, 264, 1165, 1975, 2322, 2548, 2766
BsmAI GTCTC 7 cut(s) 512, 912, 1484, 1559, 1723, 2230, 2657
BsmBI CGTCTC 1 cut(s) 512
BsmFI GGGAC 2 cut(s) 476, 2074
BsmI GAATGC 1 cut(s) 2286
Bso31I GGTCTC 3 cut(s) 912, 2230, 2657
BsoBI CYCGRG 3 cut(s) 155, 191, 581
Bsp13I TCCGGA 1 cut(s) 277
Bsp1720I GCTNAGC 2 cut(s) 2634, 2709
Bsp19I CCATGG 4 cut(s) 894, 2647, 2677, 2703
BspACI CCGC 3 cut(s) 371, 913, 1498
BspDI ATCGAT 1 cut(s) 1242
BspEI TCCGGA 1 cut(s) 277
BspHI TCATGA 2 cut(s) 2067, 2172
BspMAI CTGCAG 1 cut(s) 1737
BspPI GGATC 6 cut(s) 124, 137, 515, 610, 1187, 2515
BspT107I GGYRCC 5 cut(s) 451, 576, 929, 1589, 2351
BspTI CTTAAG 1 cut(s) 1310
BspTNI GGTCTC 3 cut(s) 912, 2230, 2657
BsrDI GCAATG 5 cut(s) 864, 1255, 1641, 2040, 2400
BsrFI RCCGGY 3 cut(s) 356, 551, 565
BsrI ACTGG 8 cut(s) 652, 789, 1262, 1543, 1554, 1573, 2146, 2423
BssAI RCCGGY 3 cut(s) 356, 551, 565
BssT1I CCWWGG 9 cut(s) 402, 894, 1161, 1413, 1472, 2152, 2647, 2677, 2703
Bst6I CTCTTC 2 cut(s) 119, 339
BstAFI CTTAAG 1 cut(s) 1310
BstAPI GCANNNNNTGC 3 cut(s) 1130, 1835, 2735
BstC8I GCNNGC 6 cut(s) 358, 614, 2196, 2461, 2715, 2727
BstDSI CCRYGG 6 cut(s) 894, 1363, 2647, 2677, 2686, 2703
BstEII GGTNACC 2 cut(s) 568, 1541
BstH2I RGCGCY 2 cut(s) 1899, 2466
BstHHI GCGC 4 cut(s) 1224, 1898, 2383, 2465
BstMAI GTCTC 7 cut(s) 512, 912, 1484, 1559, 1723, 2230, 2657
BstNSI RCATGY 2 cut(s) 612, 1600
BstPAI GACNNNNGTC 2 cut(s) 1035, 2180
BstPI GGTNACC 2 cut(s) 568, 1541
BstSFI CTRYAG 2 cut(s) 1733, 2476
BstSLI GKGCMC 4 cut(s) 122, 1309, 1592, 2772
BstV2I GAAGAC 5 cut(s) 586, 1361, 1415, 1690, 2176
BstX2I RGATCY 2 cut(s) 129, 602
BstXI CCANNNNNNTGG 2 cut(s) 253, 2362
BstYI RGATCY 2 cut(s) 129, 602
Bsu15I ATCGAT 1 cut(s) 1242
BsuI GTATCC 2 cut(s) 869, 1611
BsuTUI ATCGAT 1 cut(s) 1242
BtgI CCRYGG 6 cut(s) 894, 1363, 2647, 2677, 2686, 2703
BtgZI GCGATG 1 cut(s) 1798
BtrI CACGTC 2 cut(s) 25, 2773
BtsI GCAGTG 2 cut(s) 994, 1824
BtsIMutI CAGTG 8 cut(s) 994, 1083, 1182, 1489, 1536, 1824, 2139, 2627
Cac8I GCNNGC 6 cut(s) 358, 614, 2196, 2461, 2715, 2727
CciI TCATGA 2 cut(s) 2067, 2172
CfoI GCGC 4 cut(s) 1224, 1898, 2383, 2465
Cfr10I RCCGGY 3 cut(s) 356, 551, 565
Cfr13I GGNCC 5 cut(s) 143, 1333, 2061, 2248, 2331
Cfr9I CCCGGG 1 cut(s) 581
ClaI ATCGAT 1 cut(s) 1242
CseI GACGC 1 cut(s) 1130
Csp6I GTAC 6 cut(s) 452, 793, 1190, 1862, 2352, 2640
CspAI ACCGGT 2 cut(s) 551, 565
CspCI CAANNNNNGTGG 4 cut(s) 1638, 1673, 2128, 2163
CviQI GTAC 6 cut(s) 452, 793, 1190, 1862, 2352, 2640
DraIII CACNNNGTG 1 cut(s) 685
DrdI GACNNNNNNGTC 1 cut(s) 1079
DseDI GACNNNNNNGTC 1 cut(s) 1079
EaeI YGGCCR 6 cut(s) 3, 243, 255, 284, 1551, 2539
Eam1104I CTCTTC 2 cut(s) 119, 339
EarI CTCTTC 2 cut(s) 119, 339
EciI GGCGGA 1 cut(s) 1487
Ecl136II GAGCTC 3 cut(s) 108, 1666, 2752
Eco130I CCWWGG 9 cut(s) 402, 894, 1161, 1413, 1472, 2152, 2647, 2677, 2703
Eco24I GRGCYC 3 cut(s) 110, 1668, 2754
Eco31I GGTCTC 3 cut(s) 912, 2230, 2657
Eco32I GATATC 1 cut(s) 2506
Eco47I GGWCC 3 cut(s) 2061, 2248, 2331
Eco53kI GAGCTC 3 cut(s) 108, 1666, 2752
Eco57I CTGAAG 2 cut(s) 2237, 2813
Eco88I CYCGRG 3 cut(s) 155, 191, 581
Eco91I GGTNACC 2 cut(s) 568, 1541
EcoICRI GAGCTC 3 cut(s) 108, 1666, 2752
EcoO109I RGGNCCY 1 cut(s) 2248
EcoO65I GGTNACC 2 cut(s) 568, 1541
EcoRV GATATC 1 cut(s) 2506
EcoT14I CCWWGG 9 cut(s) 402, 894, 1161, 1413, 1472, 2152, 2647, 2677, 2703
EcoT38I GRGCYC 3 cut(s) 110, 1668, 2754
ErhI CCWWGG 9 cut(s) 402, 894, 1161, 1413, 1472, 2152, 2647, 2677, 2703
Esp3I CGTCTC 1 cut(s) 512
FalI AAGNNNNNCTT 4 cut(s) 2117, 2149, 2561, 2593
FaqI GGGAC 2 cut(s) 476, 2074
FauNDI CATATG 1 cut(s) 2003
FbaI TGATCA 3 cut(s) 315, 1533, 2695
FblI GTMKAC 4 cut(s) 42, 1029, 2271, 2475
FriOI GRGCYC 3 cut(s) 110, 1668, 2754
FspBI CTAG 5 cut(s) 384, 389, 2739, 2801, 2836
GlaI GCGC 4 cut(s) 1223, 1897, 2382, 2464
GsaI CCCAGC 1 cut(s) 497
GsuI CTGGAG 6 cut(s) 533, 669, 1713, 2163, 2639, 2649
HaeII RGCGCY 2 cut(s) 1899, 2466
HapII CCGG 9 cut(s) 59, 278, 357, 552, 566, 582, 999, 1764, 1787
HgaI GACGC 1 cut(s) 1130
HhaI GCGC 4 cut(s) 1224, 1898, 2383, 2465
Hin6I GCGC 4 cut(s) 1222, 1896, 2381, 2463
HinP1I GCGC 4 cut(s) 1222, 1896, 2381, 2463
HincII GTYRAC 3 cut(s) 43, 726, 1030
HindII GTYRAC 3 cut(s) 43, 726, 1030
HindIII AAGCTT 1 cut(s) 1019
HinfI GANTC 9 cut(s) 205, 557, 651, 1036, 1637, 1695, 1983, 2111, 2777
HpaII CCGG 9 cut(s) 59, 278, 357, 552, 566, 582, 999, 1764, 1787
Hpy166II GTNNAC 7 cut(s) 43, 655, 726, 1030, 2272, 2476, 2642
Hpy188I TCNGA 8 cut(s) 112, 315, 378, 854, 1041, 1405, 1855, 2447
Hpy8I GTNNAC 7 cut(s) 43, 655, 726, 1030, 2272, 2476, 2642
Hpy99I CGWCG 5 cut(s) 44, 299, 1031, 2060, 2777
HpyAV CCTTC 9 cut(s) 88, 1213, 1324, 1569, 1614, 1625, 2261, 2587, 2788
HpyCH4IV ACGT 3 cut(s) 24, 39, 2772
HpySE526I ACGT 3 cut(s) 24, 39, 2772
HspAI GCGC 4 cut(s) 1222, 1896, 2381, 2463
Kpn2I TCCGGA 1 cut(s) 277
KpnI GGTACC 2 cut(s) 455, 2355
KroI GCCGGC 1 cut(s) 356
KroNI GCCGGC 1 cut(s) 358
Ksp22I TGATCA 3 cut(s) 315, 1533, 2695
LmnI GCTCC 7 cut(s) 758, 849, 1285, 2325, 2665, 2749, 2757
MaeI CTAG 5 cut(s) 384, 389, 2739, 2801, 2836
MaeII ACGT 3 cut(s) 24, 39, 2772
MfeI CAATTG 2 cut(s) 1125, 1137
MflI RGATCY 2 cut(s) 129, 602
MlsI TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
MluCI AATT 7 cut(s) 444, 762, 1125, 1137, 1293, 1650, 1936
MluNI TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
MlyI GAGTC 5 cut(s) 660, 1045, 1646, 1704, 2105
Mox20I TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
MroI TCCGGA 1 cut(s) 277
MroNI GCCGGC 1 cut(s) 356
MscI TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
MseI TTAA 6 cut(s) 527, 1311, 1527, 1725, 2259, 2762
Msp20I TGGCCA 6 cut(s) 5, 245, 257, 286, 1553, 2541
MspA1I CMGCKG 3 cut(s) 82, 497, 2267
MspCI CTTAAG 1 cut(s) 1310
MspI CCGG 9 cut(s) 59, 278, 357, 552, 566, 582, 999, 1764, 1787
MunI CAATTG 2 cut(s) 1125, 1137
Mva1269I GAATGC 1 cut(s) 2286
NaeI GCCGGC 1 cut(s) 358
NciI CCSGG 4 cut(s) 59, 582, 583, 1787
NcoI CCATGG 4 cut(s) 894, 2647, 2677, 2703
NdeI CATATG 1 cut(s) 2003
NgoMIV GCCGGC 1 cut(s) 356
NspI RCATGY 2 cut(s) 612, 1600
OliI CACNNNNGTG 1 cut(s) 1752
PaeR7I CTCGAG 1 cut(s) 155
PagI TCATGA 2 cut(s) 2067, 2172
PciI ACATGT 1 cut(s) 1596
PctI GAATGC 1 cut(s) 2286
PdiI GCCGGC 1 cut(s) 358
PfeI GAWTC 4 cut(s) 205, 557, 1983, 2777
PflFI GACNNNGTC 1 cut(s) 293
PfoI TCCNGGA 2 cut(s) 510, 2114
PinAI ACCGGT 2 cut(s) 551, 565
PleI GAGTC 5 cut(s) 659, 1044, 1645, 1703, 2105
PpsI GAGTC 5 cut(s) 659, 1044, 1645, 1703, 2105
PpuMI RGGWCCY 1 cut(s) 2248
PscI ACATGT 1 cut(s) 1596
PshAI GACNNNNGTC 2 cut(s) 1035, 2180
Psp124BI GAGCTC 3 cut(s) 110, 1668, 2754
Psp5II RGGWCCY 1 cut(s) 2248
PspEI GGTNACC 2 cut(s) 568, 1541
PspFI CCCAGC 1 cut(s) 493
PspPI GGNCC 5 cut(s) 143, 1333, 2061, 2248, 2331
PspPPI RGGWCCY 1 cut(s) 2248
PspXI VCTCGAGB 1 cut(s) 155
PstI CTGCAG 1 cut(s) 1737
PsuI RGATCY 2 cut(s) 129, 602
PsyI GACNNNGTC 1 cut(s) 293
PvuII CAGCTG 3 cut(s) 82, 497, 2267
RsaI GTAC 6 cut(s) 453, 794, 1191, 1863, 2353, 2641
RsaNI GTAC 6 cut(s) 452, 793, 1190, 1862, 2352, 2640
SacI GAGCTC 3 cut(s) 110, 1668, 2754
SalI GTCGAC 2 cut(s) 41, 1028
SaqAI TTAA 6 cut(s) 527, 1311, 1527, 1725, 2259, 2762
Sau96I GGNCC 5 cut(s) 143, 1333, 2061, 2248, 2331
SchI GAGTC 5 cut(s) 660, 1045, 1646, 1704, 2105
SfcI CTRYAG 2 cut(s) 1733, 2476
Sfr274I CTCGAG 1 cut(s) 155
SgrAI CRCCGGYG 1 cut(s) 551
SinI GGWCC 3 cut(s) 2061, 2248, 2331
SlaI CTCGAG 1 cut(s) 155
SmaI CCCGGG 1 cut(s) 583
SmlI CTYRAG 8 cut(s) 47, 155, 182, 1310, 1508, 1793, 2123, 2243
SmoI CTYRAG 8 cut(s) 47, 155, 182, 1310, 1508, 1793, 2123, 2243
Sse9I AATT 7 cut(s) 444, 762, 1125, 1137, 1293, 1650, 1936
SsiI CCGC 3 cut(s) 371, 913, 1498
SspI AATATT 1 cut(s) 2226
SspMI CTAG 5 cut(s) 384, 389, 2739, 2801, 2836
SstI GAGCTC 3 cut(s) 110, 1668, 2754
StyI CCWWGG 9 cut(s) 402, 894, 1161, 1413, 1472, 2152, 2647, 2677, 2703
TaiI ACGT 3 cut(s) 27, 42, 2775
TasI AATT 7 cut(s) 444, 762, 1125, 1137, 1293, 1650, 1936
TatI WGTACW 1 cut(s) 1861
TauI GCSGC 1 cut(s) 374
TfiI GAWTC 4 cut(s) 205, 557, 1983, 2777
Tru1I TTAA 6 cut(s) 527, 1311, 1527, 1725, 2259, 2762
Tru9I TTAA 6 cut(s) 527, 1311, 1527, 1725, 2259, 2762
TscAI CASTG 8 cut(s) 994, 1083, 1189, 1489, 1543, 1824, 2146, 2627
TspDTI ATGAA 9 cut(s) 187, 328, 1353, 1365, 1446, 1596, 1946, 1975, 2017
TspGWI ACGGA 3 cut(s) 877, 1958, 2513
TspMI CCCGGG 1 cut(s) 581
TspRI CASTG 8 cut(s) 994, 1083, 1189, 1489, 1543, 1824, 2146, 2627
Tth111I GACNNNGTC 1 cut(s) 293
Vha464I CTTAAG 1 cut(s) 1310
VpaK11BI GGWCC 3 cut(s) 2061, 2248, 2331
XapI RAATTY 1 cut(s) 444
XceI RCATGY 2 cut(s) 612, 1600
XcmI CCANNNNNNNNNTGG 3 cut(s) 662, 961, 1553
XhoI CTCGAG 1 cut(s) 155
XmaI CCCGGG 1 cut(s) 581
XmiI GTMKAC 4 cut(s) 42, 1029, 2271, 2475
XspI CTAG 5 cut(s) 384, 389, 2739, 2801, 2836
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.