Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005287.1

Orthogroup ID

OG0007207

Physical Location & Seq

Genomic Coordinates Forward (+)

28962 .. 29826

Gene Structure 865 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005287.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

atgaaccctacttccacaccagattcaacctctccagttactacaacccccttttctactaccacaacatcatccacttctgcaagttggtgtgttgctagcccaagtgcatcacaaatggcattacaagttgccttggactatgcttgtggctatggtggcactgattgttcagagattcagcttggtcgaagttgttacaacccaaatactgtccgagaccatgcttcttttgcattcaataacttttatcagaagaatccagtcccaaatagctgcaattttggtggcactgctgtcatcaccaacaatgatccaagtactgggacatgtcaatatccatccactagcacaagttcatcggttttgaacacaacaaattcaagtggctcaacggttttcggtgcagtaccttctggtccttctacctcttcagcagctgctgctgcaagttcgcacagcctgcgaaacttgttcactatgatgtctctgacggtggttctactcgcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

170

Amino Acids

17.42

Weight (kDa)

5.33

Isoelectric Point (pI)

47.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007207)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30933 AT2G30933 AT2G30933
fragaria_vesca	FvH4_6g38290 FvH4_6g38290 FvH4_6g38290 FvH4_6g38290
malus_domestica	MD09G1151300.v1.1 MD17G1139000.v1.1
prunus_persica	Prupe.3G173500_v2.0.a1 Prupe.3G173500_v2.0.a1 Prupe.3G173500_v2.0.a1 Prupe.3G173500_v2.0.a1
pyrus_communis	pycom17g13200
rosa_chinensis	RchiOBHm_Chr2g0151601
rosa_laevigata	RLG00000020562
rosa_multiflora	Rmu_co8483005.1_g000001 Rmu_sc0005287.1_g000008
rosa_roxburghii	Rroxscaffold_2G00096330
rosa_rugosa	Rorug02G0427100
rosa_samantha	Rh2AG488000 Rh2BG500600 Rh2CG474500 Rh2DG511800
rosa_wichuraiana	Rw2G040000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	323
AclWI	GGATC	1 cut(s)	308
AcsI	RAATTY	1 cut(s)	379
AcuI	CTGAAG	1 cut(s)	417
AfaI	GTAC	2 cut(s)	322, 411
AfiI	CCNNNNNNNGG	1 cut(s)	323
AflIII	ACRYGT	1 cut(s)	329
AgsI	TTSAA	4 cut(s)	27, 241, 370, 384
AloI	GAACNNNNNNTCC	1 cut(s)	28
AluBI	AGCT	3 cut(s)	184, 276, 440
AluI	AGCT	3 cut(s)	184, 276, 440
Alw26I	GTCTC	2 cut(s)	213, 492
AlwI	GGATC	1 cut(s)	308
AlwNI	CAGNNNCTG	2 cut(s)	440, 443
ApeKI	GCWGC	5 cut(s)	276, 437, 440, 443, 446
ApoI	RAATTY	1 cut(s)	379
AspS9I	GGNCC	1 cut(s)	419
AsuHPI	GGTGA	1 cut(s)	295
AsuNHI	GCTAGC	1 cut(s)	98
AvaII	GGWCC	1 cut(s)	419
BbvI	GCAGC	5 cut(s)	263, 427, 430, 433, 449
BccI	CCATC	1 cut(s)	349
BcoDI	GTCTC	2 cut(s)	213, 492
BfaI	CTAG	2 cut(s)	99, 348
BisI	GCNGC	5 cut(s)	277, 438, 441, 444, 447
BlsI	GCNGC	5 cut(s)	278, 439, 442, 445, 448
BmcAI	AGTACT	1 cut(s)	322
Bme18I	GGWCC	1 cut(s)	419
BmgT120I	GGNCC	1 cut(s)	419
BmrI	ACTGGG	1 cut(s)	333
BmsI	GCATC	1 cut(s)	119
BmtI	GCTAGC	1 cut(s)	102
BmuI	ACTGGG	1 cut(s)	333
BpmI	CTGGAG	1 cut(s)	18
BsaI	GGTCTC	1 cut(s)	213
BsaJI	CCNNGG	1 cut(s)	135
Bsc4I	CCNNNNNNNGG	1 cut(s)	323
Bse1I	ACTGG	3 cut(s)	35, 263, 328
BseDI	CCNNGG	1 cut(s)	135
BseGI	GGATG	2 cut(s)	71, 341
BseLI	CCNNNNNNNGG	1 cut(s)	323
BseNI	ACTGG	3 cut(s)	35, 263, 328
BseXI	GCAGC	5 cut(s)	263, 427, 430, 433, 449
BsgI	GTGCAG	1 cut(s)	426
BslFI	GGGAC	2 cut(s)	251, 340
BslI	CCNNNNNNNGG	1 cut(s)	323
BsmAI	GTCTC	2 cut(s)	213, 492
BsmFI	GGGAC	2 cut(s)	251, 340
BsmI	GAATGC	1 cut(s)	236
Bso31I	GGTCTC	1 cut(s)	213
Bsp143I	GATC	1 cut(s)	313
BspOI	GCTAGC	1 cut(s)	102
BspPI	GGATC	1 cut(s)	308
BspTNI	GGTCTC	1 cut(s)	213
BsrI	ACTGG	3 cut(s)	35, 263, 328
BssECI	CCNNGG	1 cut(s)	135
BssMI	GATC	1 cut(s)	313
BssT1I	CCWWGG	1 cut(s)	135
Bst4CI	ACNGT	3 cut(s)	214, 397, 496
Bst6I	CTCTTC	1 cut(s)	436
BstAPI	GCANNNNNTGC	2 cut(s)	443, 463
BstC8I	GCNNGC	2 cut(s)	100, 464
BstF5I	GGATG	2 cut(s)	71, 341
BstKTI	GATC	1 cut(s)	316
BstMAI	GTCTC	2 cut(s)	213, 492
BstMBI	GATC	1 cut(s)	313
BstMWI	GCNNNNNNNGC	5 cut(s)	159, 233, 443, 446, 463
BstNSI	RCATGY	1 cut(s)	333
BstV1I	GCAGC	5 cut(s)	263, 427, 430, 433, 449
BtsCI	GGATG	2 cut(s)	71, 341
BtsI	GCAGTG	1 cut(s)	291
BtsIMutI	CAGTG	2 cut(s)	162, 291
Cac8I	GCNNGC	2 cut(s)	100, 464
CaiI	CAGNNNCTG	2 cut(s)	440, 443
Cfr13I	GGNCC	1 cut(s)	419
Csp6I	GTAC	2 cut(s)	321, 410
CspCI	CAANNNNNGTGG	2 cut(s)	268, 303
CviAII	CATG	2 cut(s)	224, 330
CviJI	RGCY	7 cut(s)	102, 153, 184, 276, 390, 440, 462
CviKI_1	RGCY	7 cut(s)	102, 153, 184, 276, 390, 440, 462
CviQI	GTAC	2 cut(s)	321, 410
DpnI	GATC	1 cut(s)	315
DpnII	GATC	1 cut(s)	313
Eam1104I	CTCTTC	1 cut(s)	436
EarI	CTCTTC	1 cut(s)	436
Eco130I	CCWWGG	1 cut(s)	135
Eco31I	GGTCTC	1 cut(s)	213
Eco47I	GGWCC	1 cut(s)	419
Eco57I	CTGAAG	1 cut(s)	417
EcoT14I	CCWWGG	1 cut(s)	135
ErhI	CCWWGG	1 cut(s)	135
FaeI	CATG	2 cut(s)	227, 333
FaiI	YATR	5 cut(s)	144, 156, 225, 331, 482
FaqI	GGGAC	2 cut(s)	251, 340
FatI	CATG	2 cut(s)	223, 329
Fnu4HI	GCNGC	5 cut(s)	277, 438, 441, 444, 447
FokI	GGATG	2 cut(s)	58, 328
Fsp4HI	GCNGC	5 cut(s)	277, 438, 441, 444, 447
FspBI	CTAG	2 cut(s)	99, 348
GluI	GCNGC	5 cut(s)	277, 438, 441, 444, 447
GsuI	CTGGAG	1 cut(s)	18
Hin1II	CATG	2 cut(s)	227, 333
HinfI	GANTC	3 cut(s)	23, 178, 259
HphI	GGTGA	1 cut(s)	295
Hpy166II	GTNNAC	1 cut(s)	477
Hpy188I	TCNGA	4 cut(s)	175, 218, 255, 492
Hpy8I	GTNNAC	1 cut(s)	477
HpyAV	CCTTC	2 cut(s)	423, 432
HpyCH4III	ACNGT	3 cut(s)	214, 397, 496
HpyCH4V	TGCA	6 cut(s)	83, 110, 236, 279, 407, 449
HpyF10VI	GCNNNNNNNGC	5 cut(s)	159, 233, 443, 446, 463
Hsp92II	CATG	2 cut(s)	227, 333
Kzo9I	GATC	1 cut(s)	313
LpnPI	CCDG	6 cut(s)	33, 48, 276, 309, 402, 476
Lsp1109I	GCAGC	5 cut(s)	263, 427, 430, 433, 449
LweI	GCATC	1 cut(s)	119
MaeI	CTAG	2 cut(s)	99, 348
MaeIII	GTNAC	2 cut(s)	37, 197
MalI	GATC	1 cut(s)	315
MboI	GATC	1 cut(s)	313
MboII	GAAGA	2 cut(s)	268, 423
MluCI	AATT	2 cut(s)	280, 379
MnlI	CCTC	2 cut(s)	40, 439
MseI	TTAA	1 cut(s)	511
MslI	CAYNNNNRTG	1 cut(s)	482
MspA1I	CMGCKG	1 cut(s)	440
Mva1269I	GAATGC	1 cut(s)	236
MwoI	GCNNNNNNNGC	5 cut(s)	159, 233, 443, 446, 463
NdeII	GATC	1 cut(s)	313
NheI	GCTAGC	1 cut(s)	98
NlaIII	CATG	2 cut(s)	227, 333
NspI	RCATGY	1 cut(s)	333
PciI	ACATGT	1 cut(s)	329
PctI	GAATGC	1 cut(s)	236
PfeI	GAWTC	3 cut(s)	23, 178, 259
PflMI	CCANNNNNTGG	1 cut(s)	323
PkrI	GCNGC	5 cut(s)	278, 439, 442, 445, 448
PscI	ACATGT	1 cut(s)	329
PspPI	GGNCC	1 cut(s)	419
PstNI	CAGNNNCTG	2 cut(s)	440, 443
PvuII	CAGCTG	1 cut(s)	440
RsaI	GTAC	2 cut(s)	322, 411
RsaNI	GTAC	2 cut(s)	321, 410
RseI	CAYNNNNRTG	1 cut(s)	482
SaqAI	TTAA	1 cut(s)	511
SatI	GCNGC	5 cut(s)	277, 438, 441, 444, 447
Sau3AI	GATC	1 cut(s)	313
Sau96I	GGNCC	1 cut(s)	419
ScaI	AGTACT	1 cut(s)	322
SetI	ASST	6 cut(s)	32, 186, 278, 415, 431, 442
SfaNI	GCATC	1 cut(s)	119
SinI	GGWCC	1 cut(s)	419
SmiMI	CAYNNNNRTG	1 cut(s)	482
Sse9I	AATT	2 cut(s)	280, 379
SspMI	CTAG	2 cut(s)	99, 348
StyI	CCWWGG	1 cut(s)	135
TaaI	ACNGT	3 cut(s)	214, 397, 496
TaqI	TCGA	1 cut(s)	190
TasI	AATT	2 cut(s)	280, 379
TatI	WGTACW	1 cut(s)	320
TfiI	GAWTC	3 cut(s)	23, 178, 259
Tru1I	TTAA	1 cut(s)	511
Tru9I	TTAA	1 cut(s)	511
TscAI	CASTG	2 cut(s)	169, 298
TseI	GCWGC	5 cut(s)	276, 437, 440, 443, 446
TspDTI	ATGAA	2 cut(s)	17, 348
TspRI	CASTG	2 cut(s)	169, 298
Van91I	CCANNNNNTGG	1 cut(s)	323
VpaK11BI	GGWCC	1 cut(s)	419
XapI	RAATTY	1 cut(s)	379
XceI	RCATGY	1 cut(s)	333
XspI	CTAG	2 cut(s)	99, 348
ZrmI	AGTACT	1 cut(s)	322

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.