Rmu_sc0005446.1_g000007

Plays a role in vesicular protein sorting

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005446.1
OG0016980
Physical Location & Seq
Forward (+)
19149 .. 21514
2366 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 510 bp
atgcgagtgttcaatgagttgaggaagctggaaatattcttcaaggatgagagcaggcatggcgttttgataattgatttgtacaaccttgttcagcatgctgacaacatcctattaagattgctgtggaccttggacagtgtaggtacctttcagtatggtccctattgtatagaggccgatgacttgcatgctgtagtccaacacttctctggagtaaattgtgtaccaagtgcaatcattgggcacagtaaaggtgtgtttttgggttacaaatggggtgaatcaggaggcatgagcttcaattcgttaactcagggaatcagggccttggcattcggtaattgtctagctaaatatgatgctgacccagcggcaaaggcagctgctgcaactgtcctgggcatccaagttgggtgtgaattgcattcaggagatgaatctagagctaatgttgcacaagataatgaacttgtccatattgcaatattacttgtgggtgaggattga

Protein Analysis

169

Amino Acids

18.42

Weight (kDa)

5.24

Isoelectric Point (pI)

31.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vps35 PF03635 1 - 41 1.2e-08 Vacuolar protein sorting-associated protein 35
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 146
AccB1I GGYRCC 1 cut(s) 146
AciI CCGC 1 cut(s) 374
AfaI GTAC 3 cut(s) 83, 148, 228
AgsI TTSAA 3 cut(s) 13, 43, 304
AjnI CCWGG 1 cut(s) 399
AluBI AGCT 5 cut(s) 28, 300, 353, 386, 449
AluI AGCT 5 cut(s) 28, 300, 353, 386, 449
AlwNI CAGNNNCTG 1 cut(s) 389
AoxI GGCC 2 cut(s) 177, 327
ApeKI GCWGC 3 cut(s) 383, 386, 389
Asp718I GGTACC 1 cut(s) 146
AspS9I GGNCC 3 cut(s) 129, 161, 327
AsuHPI GGTGA 1 cut(s) 293
AvaII GGWCC 2 cut(s) 129, 161
BaeGI GKGCMC 1 cut(s) 249
BanI GGYRCC 1 cut(s) 146
BbvI GCAGC 3 cut(s) 373, 376, 395
BciT130I CCWGG 1 cut(s) 401
BfaI CTAG 2 cut(s) 350, 444
BfmI CTRYAG 1 cut(s) 195
BisI GCNGC 4 cut(s) 375, 384, 387, 390
BlsI GCNGC 4 cut(s) 376, 385, 388, 391
Bme1390I CCNGG 1 cut(s) 401
Bme18I GGWCC 2 cut(s) 129, 161
BmgT120I GGNCC 3 cut(s) 129, 161, 327
BmiI GGNNCC 2 cut(s) 148, 163
BmrFI CCNGG 1 cut(s) 401
BmsI GCATC 2 cut(s) 352, 414
BpmI CTGGAG 1 cut(s) 234
BsaJI CCNNGG 3 cut(s) 132, 330, 400
BseBI CCWGG 1 cut(s) 401
BseDI CCNNGG 3 cut(s) 132, 330, 400
BseGI GGATG 3 cut(s) 52, 108, 405
BseMII CTCAG 1 cut(s) 329
BseSI GKGCMC 1 cut(s) 249
BseXI GCAGC 3 cut(s) 373, 376, 395
BseYI CCCAGC 1 cut(s) 370
BshFI GGCC 2 cut(s) 179, 329
BshNI GGYRCC 1 cut(s) 146
BslFI GGGAC 1 cut(s) 147
BsmFI GGGAC 1 cut(s) 147
BsmI GAATGC 2 cut(s) 335, 427
BsnI GGCC 2 cut(s) 179, 329
Bsp1286I GDGCHC 1 cut(s) 249
Bsp1407I TGTACA 1 cut(s) 81
BspACI CCGC 1 cut(s) 374
BspANI GGCC 2 cut(s) 179, 329
BspCNI CTCAG 1 cut(s) 328
BspLI GGNNCC 2 cut(s) 148, 163
BspT107I GGYRCC 1 cut(s) 146
BsrGI TGTACA 1 cut(s) 81
BssECI CCNNGG 3 cut(s) 132, 330, 400
BssT1I CCWWGG 2 cut(s) 132, 330
Bst2UI CCWGG 1 cut(s) 401
Bst4CI ACNGT 3 cut(s) 140, 251, 397
BstAPI GCANNNNNTGC 1 cut(s) 389
BstAUI TGTACA 1 cut(s) 81
BstC8I GCNNGC 3 cut(s) 56, 99, 192
BstDEI CTNAG 1 cut(s) 315
BstF5I GGATG 3 cut(s) 52, 108, 405
BstMWI GCNNNNNNNGC 6 cut(s) 60, 371, 380, 383, 389, 455
BstNI CCWGG 1 cut(s) 401
BstNSI RCATGY 2 cut(s) 101, 194
BstSCI CCNGG 1 cut(s) 399
BstSFI CTRYAG 1 cut(s) 195
BstSLI GKGCMC 1 cut(s) 249
BstV1I GCAGC 3 cut(s) 373, 376, 395
BsuRI GGCC 2 cut(s) 179, 329
BtsCI GGATG 3 cut(s) 52, 108, 405
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 3 cut(s) 56, 99, 192
CaiI CAGNNNCTG 1 cut(s) 389
Cfr13I GGNCC 3 cut(s) 129, 161, 327
Csp6I GTAC 3 cut(s) 82, 147, 227
CviAII CATG 4 cut(s) 59, 98, 191, 295
CviJI RGCY 7 cut(s) 28, 179, 300, 329, 353, 386, 449
CviKI_1 RGCY 7 cut(s) 28, 179, 300, 329, 353, 386, 449
CviQI GTAC 3 cut(s) 82, 147, 227
DdeI CTNAG 1 cut(s) 315
Eco130I CCWWGG 2 cut(s) 132, 330
Eco47I GGWCC 2 cut(s) 129, 161
EcoO109I RGGNCCY 1 cut(s) 327
EcoRII CCWGG 1 cut(s) 399
EcoT14I CCWWGG 2 cut(s) 132, 330
ErhI CCWWGG 2 cut(s) 132, 330
FaeI CATG 4 cut(s) 62, 101, 194, 298
FaiI YATR 8 cut(s) 60, 99, 159, 173, 192, 296, 360, 480
FaqI GGGAC 1 cut(s) 147
FatI CATG 4 cut(s) 58, 97, 190, 294
Fnu4HI GCNGC 4 cut(s) 375, 384, 387, 390
FokI GGATG 3 cut(s) 59, 95, 392
Fsp4HI GCNGC 4 cut(s) 375, 384, 387, 390
FspBI CTAG 2 cut(s) 350, 444
GluI GCNGC 4 cut(s) 375, 384, 387, 390
GsaI CCCAGC 1 cut(s) 374
GsuI CTGGAG 1 cut(s) 234
HaeIII GGCC 2 cut(s) 179, 329
Hin1II CATG 4 cut(s) 62, 101, 194, 298
HincII GTYRAC 1 cut(s) 312
HindII GTYRAC 1 cut(s) 312
HinfI GANTC 3 cut(s) 284, 321, 440
HpaI GTTAAC 1 cut(s) 312
HphI GGTGA 1 cut(s) 293
Hpy166II GTNNAC 3 cut(s) 129, 227, 312
Hpy188III TCNNGA 4 cut(s) 213, 288, 432, 444
Hpy8I GTNNAC 3 cut(s) 129, 227, 312
HpyCH4III ACNGT 3 cut(s) 140, 251, 397
HpyCH4V TGCA 6 cut(s) 190, 236, 392, 427, 458, 485
HpyF10VI GCNNNNNNNGC 6 cut(s) 60, 371, 380, 383, 389, 455
HpyF3I CTNAG 1 cut(s) 315
Hsp92II CATG 4 cut(s) 62, 101, 194, 298
KpnI GGTACC 1 cut(s) 150
KspAI GTTAAC 1 cut(s) 312
Lsp1109I GCAGC 3 cut(s) 373, 376, 395
LweI GCATC 2 cut(s) 352, 414
MaeI CTAG 2 cut(s) 350, 444
MaeIII GTNAC 1 cut(s) 269
MboII GAAGA 1 cut(s) 31
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 5 cut(s) 72, 220, 304, 343, 422
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 4 cut(s) 15, 169, 284, 496
MseI TTAA 2 cut(s) 116, 311
MspA1I CMGCKG 2 cut(s) 374, 386
MspR9I CCNGG 1 cut(s) 401
Mva1269I GAATGC 2 cut(s) 335, 427
MvaI CCWGG 1 cut(s) 401
MwoI GCNNNNNNNGC 6 cut(s) 60, 371, 380, 383, 389, 455
NlaIII CATG 4 cut(s) 62, 101, 194, 298
NlaIV GGNNCC 2 cut(s) 148, 163
NspI RCATGY 2 cut(s) 101, 194
PaeI GCATGC 2 cut(s) 101, 194
PctI GAATGC 2 cut(s) 335, 427
PfeI GAWTC 3 cut(s) 284, 321, 440
PkrI GCNGC 4 cut(s) 376, 385, 388, 391
Psp6I CCWGG 1 cut(s) 399
PspFI CCCAGC 1 cut(s) 370
PspGI CCWGG 1 cut(s) 399
PspN4I GGNNCC 2 cut(s) 148, 163
PspPI GGNCC 3 cut(s) 129, 161, 327
PstNI CAGNNNCTG 1 cut(s) 389
PvuII CAGCTG 1 cut(s) 386
RsaI GTAC 3 cut(s) 83, 148, 228
RsaNI GTAC 3 cut(s) 82, 147, 227
SaqAI TTAA 2 cut(s) 116, 311
SatI GCNGC 4 cut(s) 375, 384, 387, 390
Sau96I GGNCC 3 cut(s) 129, 161, 327
ScrFI CCNGG 1 cut(s) 401
SduI GDGCHC 1 cut(s) 249
SfaNI GCATC 2 cut(s) 352, 414
SfcI CTRYAG 1 cut(s) 195
SinI GGWCC 2 cut(s) 129, 161
SphI GCATGC 2 cut(s) 101, 194
Sse9I AATT 5 cut(s) 72, 220, 304, 343, 422
SsiI CCGC 1 cut(s) 374
SspI AATATT 2 cut(s) 36, 489
SspMI CTAG 2 cut(s) 350, 444
StyD4I CCNGG 1 cut(s) 399
StyI CCWWGG 2 cut(s) 132, 330
TaaI ACNGT 3 cut(s) 140, 251, 397
TasI AATT 5 cut(s) 72, 220, 304, 343, 422
TatI WGTACW 1 cut(s) 81
TauI GCSGC 1 cut(s) 377
TfiI GAWTC 3 cut(s) 284, 321, 440
Tru1I TTAA 2 cut(s) 116, 311
Tru9I TTAA 2 cut(s) 116, 311
TscAI CASTG 1 cut(s) 145
TseI GCWGC 3 cut(s) 383, 386, 389
TspDTI ATGAA 2 cut(s) 453, 483
TspRI CASTG 1 cut(s) 145
VpaK11BI GGWCC 2 cut(s) 129, 161
XbaI TCTAGA 1 cut(s) 443
XceI RCATGY 2 cut(s) 101, 194
XcmI CCANNNNNNNNNTGG 1 cut(s) 209
XspI CTAG 2 cut(s) 350, 444
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.