Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005639.1

Orthogroup ID

OG0012598

Physical Location & Seq

Genomic Coordinates Forward (+)

119455 .. 120120

Gene Structure 666 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005639.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 666 bp

atggcaagttctttagtatgtttggcatctctttccctcgtcttcattttcatctccatccctctcccgtactccacagctatctcctcctgcaatggcgcatgcaaaaccttgaacgactgtgctggtcaactaatctgtatcaaccaaaaatgcaacgatgaccccgatgttgggactcacatatgcggcaggggtgggggaggaggctcatcaccttctcctagccccaacaattgcagaccctttggaacactggtttgcaagggcaagtcgtaccctaaatcctcgtgctctcccccagtaacatcatccaccaaagccctacttacactcaacgttttcagcgaaggcggtgatgggggcgggccatcagaatgtgacgaacaatatcattcaaacagtgagcgggttgtggcactttccactggggggtttgataataaatcgaggtgcgggaagttaataagaattcaggcaagtaatgggaagactacgactgcgagagtggtggatgaatgtgattcacgtaatggatgtgataaagagcatgcagggcagccgacgtgtgaaaacaatatcgtggatggatctgcatctgtgtggaacgctttgggactcgatcaggatgtaggtaaggtgtcggtgacttggtccatggcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

221

Amino Acids

22.86

Weight (kDa)

5.89

Isoelectric Point (pI)

50.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012598)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g31600 FvH4_3g31620 FvH4_4g25200
malus_domestica	MD11G1140700.v1.1
prunus_persica	Prupe.6G105400_v2.0.a1 Prupe.6G105800_v2.0.a1
pyrus_communis	pycom11g11660
rosa_chinensis	RchiOBHm_Chr5g0022271 RchiOBHm_Chr5g0058241
rosa_laevigata	RLG00000035206
rosa_multiflora	Rmu_sc0000367.1_g000052 Rmu_sc0005639.1_g000026
rosa_roxburghii	Rroxscaffold_1G00022290
rosa_rugosa	Rorug05G0073000 Rorug05G0312800
rosa_samantha	Rh5DG159800 Rh5DG406900
rosa_wichuraiana	Rw5G014290 Rw5G035850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	409
AciI	CCGC	5 cut(s)	189, 354, 366, 409, 456
AclI	AACGTT	1 cut(s)	339
AclWI	GGATC	1 cut(s)	598
AcsI	RAATTY	1 cut(s)	471
AfaI	GTAC	2 cut(s)	71, 278
AfiI	CCNNNNNNNGG	3 cut(s)	173, 174, 432
AflIII	ACRYGT	1 cut(s)	566
AgsI	TTSAA	2 cut(s)	115, 399
AjiI	CACGTC	1 cut(s)	567
AluBI	AGCT	1 cut(s)	80
AluI	AGCT	1 cut(s)	80
Alw21I	GWGCWC	1 cut(s)	296
AlwI	GGATC	1 cut(s)	598
AoxI	GGCC	1 cut(s)	368
ApeKI	GCWGC	1 cut(s)	559
ApoI	RAATTY	1 cut(s)	471
AspLEI	GCGC	1 cut(s)	101
AspS9I	GGNCC	2 cut(s)	368, 654
AsuHPI	GGTGA	3 cut(s)	207, 368, 658
AvaII	GGWCC	1 cut(s)	654
BauI	CACGAG	1 cut(s)	289
BbsI	GAAGAC	2 cut(s)	34, 497
Bbv12I	GWGCWC	1 cut(s)	296
BbvI	GCAGC	1 cut(s)	571
BccI	CCATC	4 cut(s)	65, 353, 379, 581
BfaI	CTAG	1 cut(s)	225
BisI	GCNGC	2 cut(s)	190, 560
BlsI	GCNGC	2 cut(s)	191, 561
Bme18I	GGWCC	1 cut(s)	654
BmgBI	CACGTC	1 cut(s)	567
BmgT120I	GGNCC	2 cut(s)	368, 654
BmrI	ACTGGG	2 cut(s)	296, 438
BmsI	GCATC	2 cut(s)	35, 605
BmuI	ACTGGG	2 cut(s)	296, 438
BpiI	GAAGAC	2 cut(s)	34, 497
BsaAI	YACGTR	1 cut(s)	530
BsaBI	GATNNNNATC	1 cut(s)	595
BsaJI	CCNNGG	1 cut(s)	657
Bsc4I	CCNNNNNNNGG	3 cut(s)	173, 174, 432
Bse1I	ACTGG	3 cut(s)	261, 302, 433
Bse3DI	GCAATG	1 cut(s)	100
Bse8I	GATNNNNATC	1 cut(s)	595
BseDI	CCNNGG	1 cut(s)	657
BseGI	GGATG	6 cut(s)	57, 311, 520, 542, 592, 634
BseJI	GATNNNNATC	1 cut(s)	595
BseLI	CCNNNNNNNGG	3 cut(s)	173, 174, 432
BseMI	GCAATG	1 cut(s)	100
BseNI	ACTGG	3 cut(s)	261, 302, 433
BseRI	GAGGAG	2 cut(s)	76, 219
BseXI	GCAGC	1 cut(s)	571
BshFI	GGCC	1 cut(s)	370
BsiHKAI	GWGCWC	1 cut(s)	296
BslFI	GGGAC	2 cut(s)	190, 630
BslI	CCNNNNNNNGG	3 cut(s)	173, 174, 432
BsmFI	GGGAC	2 cut(s)	190, 630
BsnI	GGCC	1 cut(s)	370
Bsp1286I	GDGCHC	1 cut(s)	296
Bsp143I	GATC	2 cut(s)	590, 622
Bsp19I	CCATGG	1 cut(s)	657
BspACI	CCGC	5 cut(s)	189, 354, 366, 409, 456
BspANI	GGCC	1 cut(s)	370
BspPI	GGATC	1 cut(s)	598
BsrBI	CCGCTC	1 cut(s)	409
BsrDI	GCAATG	1 cut(s)	100
BsrI	ACTGG	3 cut(s)	261, 302, 433
BssECI	CCNNGG	1 cut(s)	657
BssMI	GATC	2 cut(s)	590, 622
BssSI	CACGAG	1 cut(s)	289
BssT1I	CCWWGG	1 cut(s)	657
Bst2BI	CACGAG	1 cut(s)	289
Bst4CI	ACNGT	2 cut(s)	122, 404
BstBAI	YACGTR	1 cut(s)	530
BstC8I	GCNNGC	3 cut(s)	103, 368, 552
BstDSI	CCRYGG	1 cut(s)	657
BstF5I	GGATG	6 cut(s)	57, 311, 520, 542, 592, 634
BstHHI	GCGC	1 cut(s)	101
BstKTI	GATC	2 cut(s)	593, 625
BstMBI	GATC	2 cut(s)	590, 622
BstMWI	GCNNNNNNNGC	1 cut(s)	556
BstNSI	RCATGY	2 cut(s)	105, 554
BstV1I	GCAGC	1 cut(s)	571
BstV2I	GAAGAC	2 cut(s)	34, 497
BstX2I	RGATCY	1 cut(s)	590
BstYI	RGATCY	1 cut(s)	590
BsuRI	GGCC	1 cut(s)	370
BtgI	CCRYGG	1 cut(s)	657
BtrI	CACGTC	1 cut(s)	567
BtsCI	GGATG	6 cut(s)	57, 311, 520, 542, 592, 634
BtsIMutI	CAGTG	3 cut(s)	254, 409, 426
Cac8I	GCNNGC	3 cut(s)	103, 368, 552
CfoI	GCGC	1 cut(s)	101
Cfr13I	GGNCC	2 cut(s)	368, 654
Csp6I	GTAC	2 cut(s)	70, 277
CviAII	CATG	4 cut(s)	102, 551, 658, 663
CviJI	RGCY	6 cut(s)	80, 210, 228, 323, 370, 562
CviKI_1	RGCY	6 cut(s)	80, 210, 228, 323, 370, 562
CviQI	GTAC	2 cut(s)	70, 277
DpnI	GATC	2 cut(s)	592, 624
DpnII	GATC	2 cut(s)	590, 622
Eco130I	CCWWGG	1 cut(s)	657
Eco47I	GGWCC	1 cut(s)	654
EcoRI	GAATTC	1 cut(s)	471
EcoT14I	CCWWGG	1 cut(s)	657
ErhI	CCWWGG	1 cut(s)	657
FaeI	CATG	4 cut(s)	105, 554, 661, 666
FaiI	YATR	7 cut(s)	19, 103, 185, 187, 552, 659, 664
FalI	AAGNNNNNCTT	2 cut(s)	312, 344
FaqI	GGGAC	2 cut(s)	190, 630
FatI	CATG	4 cut(s)	101, 550, 657, 662
FauI	CCCGC	3 cut(s)	359, 402, 449
FauNDI	CATATG	1 cut(s)	185
Fnu4HI	GCNGC	2 cut(s)	190, 560
FokI	GGATG	6 cut(s)	44, 298, 527, 549, 599, 641
Fsp4HI	GCNGC	2 cut(s)	190, 560
FspBI	CTAG	1 cut(s)	225
GlaI	GCGC	1 cut(s)	100
GluI	GCNGC	2 cut(s)	190, 560
HaeIII	GGCC	1 cut(s)	370
HhaI	GCGC	1 cut(s)	101
Hin1II	CATG	4 cut(s)	105, 554, 661, 666
Hin6I	GCGC	1 cut(s)	99
HinP1I	GCGC	1 cut(s)	99
HincII	GTYRAC	1 cut(s)	131
HindII	GTYRAC	1 cut(s)	131
HinfI	GANTC	3 cut(s)	178, 524, 618
HphI	GGTGA	3 cut(s)	207, 368, 658
Hpy166II	GTNNAC	1 cut(s)	131
Hpy188I	TCNGA	1 cut(s)	376
Hpy188III	TCNNGA	1 cut(s)	626
Hpy8I	GTNNAC	1 cut(s)	131
Hpy99I	CGWCG	1 cut(s)	568
HpyAV	CCTTC	2 cut(s)	228, 344
HpyCH4III	ACNGT	2 cut(s)	122, 404
HpyCH4IV	ACGT	3 cut(s)	339, 529, 566
HpyCH4V	TGCA	7 cut(s)	93, 105, 156, 240, 264, 554, 596
HpyF10VI	GCNNNNNNNGC	1 cut(s)	556
HpySE526I	ACGT	3 cut(s)	339, 529, 566
Hsp92II	CATG	4 cut(s)	105, 554, 661, 666
HspAI	GCGC	1 cut(s)	99
Kzo9I	GATC	2 cut(s)	590, 622
LpnPI	CCDG	9 cut(s)	103, 111, 178, 242, 315, 414, 461, 540, 611
Lsp1109I	GCAGC	1 cut(s)	571
LweI	GCATC	2 cut(s)	35, 605
MaeI	CTAG	1 cut(s)	225
MaeII	ACGT	3 cut(s)	339, 529, 566
MaeIII	GTNAC	3 cut(s)	304, 380, 646
MalI	GATC	2 cut(s)	592, 624
MbiI	CCGCTC	1 cut(s)	409
MboI	GATC	2 cut(s)	590, 622
MboII	GAAGA	2 cut(s)	34, 502
MfeI	CAATTG	1 cut(s)	235
MflI	RGATCY	1 cut(s)	590
MhlI	GDGCHC	1 cut(s)	296
MluCI	AATT	2 cut(s)	235, 471
MlyI	GAGTC	2 cut(s)	172, 612
MnlI	CCTC	7 cut(s)	47, 72, 97, 197, 200, 298, 444
MseI	TTAA	1 cut(s)	464
MslI	CAYNNNNRTG	2 cut(s)	376, 601
MunI	CAATTG	1 cut(s)	235
MwoI	GCNNNNNNNGC	1 cut(s)	556
NcoI	CCATGG	1 cut(s)	657
NdeI	CATATG	1 cut(s)	185
NdeII	GATC	2 cut(s)	590, 622
NlaIII	CATG	4 cut(s)	105, 554, 661, 666
NmuCI	GTSAC	2 cut(s)	380, 646
NspI	RCATGY	2 cut(s)	105, 554
PaeI	GCATGC	2 cut(s)	105, 554
PcsI	WCGNNNNNNNCGW	2 cut(s)	165, 345
PfeI	GAWTC	1 cut(s)	524
PflFI	GACNNNGTC	1 cut(s)	652
PkrI	GCNGC	2 cut(s)	191, 561
PleI	GAGTC	2 cut(s)	172, 612
PpsI	GAGTC	2 cut(s)	172, 612
Ppu21I	YACGTR	1 cut(s)	530
Psp1406I	AACGTT	1 cut(s)	339
PspPI	GGNCC	2 cut(s)	368, 654
PsuI	RGATCY	1 cut(s)	590
PsyI	GACNNNGTC	1 cut(s)	652
RsaI	GTAC	2 cut(s)	71, 278
RsaNI	GTAC	2 cut(s)	70, 277
RseI	CAYNNNNRTG	2 cut(s)	376, 601
SaqAI	TTAA	1 cut(s)	464
SatI	GCNGC	2 cut(s)	190, 560
Sau3AI	GATC	2 cut(s)	590, 622
Sau96I	GGNCC	2 cut(s)	368, 654
SchI	GAGTC	2 cut(s)	172, 612
SduI	GDGCHC	1 cut(s)	296
SetI	ASST	9 cut(s)	82, 113, 220, 342, 455, 532, 569, 637, 642
SfaNI	GCATC	2 cut(s)	35, 605
SinI	GGWCC	1 cut(s)	654
SmiMI	CAYNNNNRTG	2 cut(s)	376, 601
SphI	GCATGC	2 cut(s)	105, 554
Sse9I	AATT	2 cut(s)	235, 471
SsiI	CCGC	5 cut(s)	189, 354, 366, 409, 456
SspMI	CTAG	1 cut(s)	225
StyI	CCWWGG	1 cut(s)	657
TaaI	ACNGT	2 cut(s)	122, 404
TaiI	ACGT	3 cut(s)	342, 532, 569
TaqI	TCGA	2 cut(s)	449, 621
TasI	AATT	2 cut(s)	235, 471
TauI	GCSGC	1 cut(s)	192
TfiI	GAWTC	1 cut(s)	524
Tru1I	TTAA	1 cut(s)	464
Tru9I	TTAA	1 cut(s)	464
TscAI	CASTG	3 cut(s)	261, 409, 433
TseFI	GTSAC	2 cut(s)	380, 646
TseI	GCWGC	1 cut(s)	559
Tsp45I	GTSAC	2 cut(s)	380, 646
TspDTI	ATGAA	3 cut(s)	34, 40, 531
TspRI	CASTG	3 cut(s)	261, 409, 433
Tth111I	GACNNNGTC	1 cut(s)	652
VpaK11BI	GGWCC	1 cut(s)	654
XapI	RAATTY	1 cut(s)	471
XceI	RCATGY	2 cut(s)	105, 554
XspI	CTAG	1 cut(s)	225

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.