Rmu_sc0006151.1_g000003

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006151.1
Physical Location & Seq
Forward (+)
19369 .. 19834
466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006151.1_g000003.1.cds

Sequence Viewer

Length: 393 bp
atgctgtttgtgggatcttcactttcggagactccatcttcgacgctggaaacaatcacttcaacaagaactgcactgttcaagcagatttcccaccgtatggctcaagcttcttccactacccgactggcaggttcactaatggcagttcctttctttctctccaggctatctaggagagacggatattcatctctgatatccaatgctgtttgtgggatcttcactttcggagactccatcttcgacgctggaaacaatcacttcaacaagaactgcactgttcaagcagatttcccaccgtatggctcaagcttcttccactacccgactggcaggttcactaatggcagaactgttgctgatttcatctgtaagatacctacaccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

14.19

Weight (kDa)

9.3

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016027)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 122, 327
AccB7I CCANNNNNTGG 2 cut(s) 100, 305
AclWI GGATC 2 cut(s) 22, 227
AfiI CCNNNNNNNGG 2 cut(s) 100, 305
AgsI TTSAA 4 cut(s) 63, 82, 268, 287
AjnI CCWGG 1 cut(s) 164
AluBI AGCT 2 cut(s) 110, 315
AluI AGCT 2 cut(s) 110, 315
Alw26I GTCTC 3 cut(s) 23, 174, 228
AlwI GGATC 2 cut(s) 22, 227
ArsI GACNNNNNNTTYG 4 cut(s) 22, 54, 227, 259
BccI CCATC 2 cut(s) 43, 248
BciT130I CCWGG 1 cut(s) 166
BcoDI GTCTC 3 cut(s) 23, 174, 228
BfaI CTAG 1 cut(s) 174
BfuAI ACCTGC 2 cut(s) 122, 327
Bme1390I CCNGG 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 166
BpmI CTGGAG 1 cut(s) 148
BpuEI CTTGAG 2 cut(s) 90, 295
BsaBI GATNNNNATC 1 cut(s) 190
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 305
Bse1I ACTGG 2 cut(s) 132, 337
Bse8I GATNNNNATC 1 cut(s) 190
BseBI CCWGG 1 cut(s) 166
BseJI GATNNNNATC 1 cut(s) 190
BseLI CCNNNNNNNGG 2 cut(s) 100, 305
BseNI ACTGG 2 cut(s) 132, 337
BsgI GTGCAG 2 cut(s) 57, 262
BslI CCNNNNNNNGG 2 cut(s) 100, 305
BsmAI GTCTC 3 cut(s) 23, 174, 228
BsmBI CGTCTC 1 cut(s) 174
Bsp143I GATC 2 cut(s) 14, 219
BspMI ACCTGC 2 cut(s) 122, 327
BspPI GGATC 2 cut(s) 22, 227
BsrI ACTGG 2 cut(s) 132, 337
BssMI GATC 2 cut(s) 14, 219
Bst2UI CCWGG 1 cut(s) 166
Bst4CI ACNGT 5 cut(s) 78, 98, 283, 303, 358
BstKTI GATC 2 cut(s) 17, 222
BstMAI GTCTC 3 cut(s) 23, 174, 228
BstMBI GATC 2 cut(s) 14, 219
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstX2I RGATCY 2 cut(s) 14, 219
BstYI RGATCY 2 cut(s) 14, 219
BtsIMutI CAGTG 2 cut(s) 74, 279
BveI ACCTGC 2 cut(s) 122, 327
CseI GACGC 2 cut(s) 52, 257
CviJI RGCY 5 cut(s) 104, 110, 169, 309, 315
CviKI_1 RGCY 5 cut(s) 104, 110, 169, 309, 315
DpnI GATC 2 cut(s) 16, 221
DpnII GATC 2 cut(s) 14, 219
Eco32I GATATC 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 164
EcoRV GATATC 1 cut(s) 201
Esp3I CGTCTC 1 cut(s) 174
FaiI YATR 3 cut(s) 101, 306, 391
FspBI CTAG 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 148
HgaI GACGC 2 cut(s) 52, 257
HindIII AAGCTT 2 cut(s) 108, 313
HinfI GANTC 2 cut(s) 31, 236
Hpy166II GTNNAC 2 cut(s) 137, 342
Hpy188I TCNGA 3 cut(s) 28, 198, 233
Hpy8I GTNNAC 2 cut(s) 137, 342
Hpy99I CGWCG 2 cut(s) 46, 251
HpyCH4III ACNGT 5 cut(s) 78, 98, 283, 303, 358
HpyCH4V TGCA 2 cut(s) 74, 279
Kzo9I GATC 2 cut(s) 14, 219
LpnPI CCDG 8 cut(s) 32, 113, 117, 151, 178, 237, 318, 322
MaeI CTAG 1 cut(s) 174
MalI GATC 2 cut(s) 16, 221
MboI GATC 2 cut(s) 14, 219
MboII GAAGA 6 cut(s) 9, 30, 105, 214, 235, 310
MflI RGATCY 2 cut(s) 14, 219
MlyI GAGTC 2 cut(s) 25, 230
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
NdeII GATC 2 cut(s) 14, 219
PflMI CCANNNNNTGG 2 cut(s) 100, 305
PleI GAGTC 2 cut(s) 25, 230
PpsI GAGTC 2 cut(s) 25, 230
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PsuI RGATCY 2 cut(s) 14, 219
Sau3AI GATC 2 cut(s) 14, 219
SchI GAGTC 2 cut(s) 25, 230
ScrFI CCNGG 1 cut(s) 166
SetI ASST 5 cut(s) 112, 136, 317, 341, 385
SmlI CTYRAG 2 cut(s) 105, 310
SmoI CTYRAG 2 cut(s) 105, 310
SspMI CTAG 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 164
TaaI ACNGT 5 cut(s) 78, 98, 283, 303, 358
TaqI TCGA 2 cut(s) 41, 246
TscAI CASTG 2 cut(s) 81, 286
TspDTI ATGAA 2 cut(s) 180, 358
TspGWI ACGGA 1 cut(s) 198
TspRI CASTG 2 cut(s) 81, 286
Van91I CCANNNNNTGG 2 cut(s) 100, 305
XcmI CCANNNNNNNNNTGG 2 cut(s) 124, 329
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.