Rmu_sc0006153.1_g000022

Maf-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006153.1
OG0009805
Physical Location & Seq
Forward (+)
79387 .. 81404
2018 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 777 bp
atgtttaaggtctttgttccttgcttaacataccgtggactaaaacggtgtcgtattggttacatattcggcgaaagttcgatttggacgaaccaaattgaagcaccggcccaaaatggaaagtggatgctgaaaagggtaagctcagagaatcaaaaacaactgtggaggagaaagatgtcgtttcagataatcttgggctcggcgtcaatggcacgccggcaaatactggcggagatgggctacgagttcaaaatcaggactgcagatatagacgagaagagtatcaggatggataagccagaggagttggtgatggttctagctgaggcaaaagcagatgctatcatttcaaggatgcaaagtagtgaattagatgttggtgctgatcaaacaacactgttgattactgcagatacagtggtggtgtatgaagggataataagggaaaaaccgtccagcaaggaagaagcatgggattttatcaaaggctattctggtggtcaagcaggagttataggatctgtacttgtgaccaaccttaaaacaggaaaaagaaaaggggggtggcgcagcgcagaggtctattttcacgtcataccagaggagattattgacaacctgatagaggagggaactacactcaacgttgctgggggtctgatgcttgaacatcctatgatatcaccctttgtagaagcagtgatagggacaagtgacacggtaatgggactgcctaaagaactcacagaaaagctcatccatgaagcactctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Maf

Protein Analysis

258

Amino Acids

28.86

Weight (kDa)

6.04

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Maf PF02545 63 - 256 4.5e-42 Maf-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009805)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G25500 AT5G66550 AT5G66550 AT5G66550 AT5G66550
fragaria_vesca FvH4_1g13260 FvH4_1g13260
malus_domestica MD02G1147000.v1.1
prunus_persica Prupe.7G155200_v2.0.a1
pyrus_communis pycom02g11630
rosa_chinensis RchiOBHm_Chr2g0101501
rosa_laevigata RLG00000017083
rosa_multiflora Rmu_sc0006153.1_g000022
rosa_roxburghii Rroxscaffold_2G00141290
rosa_rugosa Rorug02G0098000 Rorug02G0098100
rosa_samantha Rh2AG147400 Rh2BG152600 Rh2CG153400 Rh2DG152800
rosa_wichuraiana Rw2G011480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 233
AclI AACGTT 1 cut(s) 648
AclWI GGATC 1 cut(s) 529
AcyI GRCGYC 1 cut(s) 206
AfaI GTAC 1 cut(s) 528
AfiI CCNNNNNNNGG 1 cut(s) 628
AgsI TTSAA 4 cut(s) 101, 253, 354, 671
AjiI CACGTC 1 cut(s) 595
AjuI GAANNNNNNNTTGG 2 cut(s) 363, 395
AluBI AGCT 3 cut(s) 144, 326, 757
AluI AGCT 3 cut(s) 144, 326, 757
AlwI GGATC 1 cut(s) 529
AoxI GGCC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 573
AspLEI GCGC 2 cut(s) 573, 578
AspS9I GGNCC 1 cut(s) 109
AsuHPI GGTGA 2 cut(s) 325, 678
BaeI ACNNNNGTAYC 2 cut(s) 408, 441
BanII GRGCYC 1 cut(s) 203
BbvCI CCTCAGC 1 cut(s) 327
BbvI GCAGC 1 cut(s) 585
BccI CCATC 3 cut(s) 232, 286, 310
BclI TGATCA 1 cut(s) 388
BfaI CTAG 1 cut(s) 323
BfmI CTRYAG 2 cut(s) 264, 411
BisI GCNGC 1 cut(s) 574
BlsI GCNGC 1 cut(s) 575
BmgBI CACGTC 1 cut(s) 595
BmgT120I GGNCC 1 cut(s) 109
BmsI GCATC 4 cut(s) 117, 331, 348, 654
Bpu10I CCTNAGC 1 cut(s) 327
BsaHI GRCGYC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 628
Bse118I RCCGGY 2 cut(s) 106, 219
Bse1I ACTGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 34
BseGI GGATG 5 cut(s) 132, 297, 363, 673, 759
BseLI CCNNNNNNNGG 1 cut(s) 628
BseMII CTCAG 2 cut(s) 159, 318
BseNI ACTGG 1 cut(s) 234
BseRI GAGGAG 4 cut(s) 184, 320, 620, 644
BseXI GCAGC 1 cut(s) 585
BseYI CCCAGC 1 cut(s) 653
BshFI GGCC 1 cut(s) 110
BsiSI CCGG 2 cut(s) 107, 220
BslFI GGGAC 2 cut(s) 724, 744
BslI CCNNNNNNNGG 1 cut(s) 628
BsmFI GGGAC 2 cut(s) 724, 744
BsnI GGCC 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 203
Bsp143I GATC 2 cut(s) 388, 521
BspACI CCGC 1 cut(s) 233
BspANI GGCC 1 cut(s) 110
BspCNI CTCAG 2 cut(s) 158, 319
BspMAI CTGCAG 2 cut(s) 268, 415
BspPI GGATC 1 cut(s) 529
BsrFI RCCGGY 2 cut(s) 106, 219
BsrI ACTGG 1 cut(s) 234
BssAI RCCGGY 2 cut(s) 106, 219
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 2 cut(s) 388, 521
BssNI GRCGYC 1 cut(s) 206
Bst4CI ACNGT 7 cut(s) 35, 48, 165, 402, 421, 456, 724
Bst6I CTCTTC 1 cut(s) 275
BstACI GRCGYC 1 cut(s) 206
BstC8I GCNNGC 2 cut(s) 217, 221
BstDEI CTNAG 2 cut(s) 145, 327
BstDSI CCRYGG 1 cut(s) 34
BstENI CCTNNNNNAGG 1 cut(s) 626
BstF5I GGATG 5 cut(s) 132, 297, 363, 673, 759
BstHHI GCGC 2 cut(s) 573, 578
BstKTI GATC 2 cut(s) 391, 524
BstMBI GATC 2 cut(s) 388, 521
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstSFI CTRYAG 2 cut(s) 264, 411
BstV1I GCAGC 1 cut(s) 585
BstX2I RGATCY 1 cut(s) 521
BstYI RGATCY 1 cut(s) 521
BsuRI GGCC 1 cut(s) 110
BtgI CCRYGG 1 cut(s) 34
BtrI CACGTC 1 cut(s) 595
BtsCI GGATG 5 cut(s) 132, 297, 363, 673, 759
BtsI GCAGTG 1 cut(s) 708
BtsIMutI CAGTG 3 cut(s) 398, 426, 708
Cac8I GCNNGC 2 cut(s) 217, 221
CfoI GCGC 2 cut(s) 573, 578
Cfr10I RCCGGY 2 cut(s) 106, 219
Cfr13I GGNCC 1 cut(s) 109
CseI GACGC 1 cut(s) 195
Csp6I GTAC 1 cut(s) 527
CviAII CATG 2 cut(s) 474, 764
CviJI RGCY 8 cut(s) 110, 144, 201, 243, 301, 326, 492, 757
CviKI_1 RGCY 8 cut(s) 110, 144, 201, 243, 301, 326, 492, 757
CviQI GTAC 1 cut(s) 527
DdeI CTNAG 2 cut(s) 145, 327
DpnI GATC 2 cut(s) 390, 523
DpnII GATC 2 cut(s) 388, 521
Eam1104I CTCTTC 1 cut(s) 275
EarI CTCTTC 1 cut(s) 275
EciI GGCGGA 1 cut(s) 248
Eco24I GRGCYC 1 cut(s) 203
Eco32I GATATC 1 cut(s) 684
EcoNI CCTNNNNNAGG 1 cut(s) 626
EcoRV GATATC 1 cut(s) 684
EcoT38I GRGCYC 1 cut(s) 203
FaeI CATG 2 cut(s) 477, 767
FaiI YATR 9 cut(s) 31, 65, 272, 432, 475, 518, 599, 680, 765
FaqI GGGAC 2 cut(s) 724, 744
FatI CATG 2 cut(s) 473, 763
FbaI TGATCA 1 cut(s) 388
Fnu4HI GCNGC 1 cut(s) 574
FokI GGATG 5 cut(s) 139, 304, 370, 660, 746
FriOI GRGCYC 1 cut(s) 203
Fsp4HI GCNGC 1 cut(s) 574
FspBI CTAG 1 cut(s) 323
GlaI GCGC 2 cut(s) 572, 577
GluI GCNGC 1 cut(s) 574
GsaI CCCAGC 1 cut(s) 657
HaeIII GGCC 1 cut(s) 110
HapII CCGG 2 cut(s) 107, 220
HgaI GACGC 1 cut(s) 195
HhaI GCGC 2 cut(s) 573, 578
Hin1I GRCGYC 1 cut(s) 206
Hin1II CATG 2 cut(s) 477, 767
Hin6I GCGC 2 cut(s) 571, 576
HinP1I GCGC 2 cut(s) 571, 576
HinfI GANTC 1 cut(s) 151
HpaII CCGG 2 cut(s) 107, 220
HphI GGTGA 2 cut(s) 325, 678
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 3 cut(s) 148, 189, 663
Hpy188III TCNNGA 2 cut(s) 259, 289
Hpy8I GTNNAC 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 428
HpyCH4III ACNGT 7 cut(s) 35, 48, 165, 402, 421, 456, 724
HpyCH4IV ACGT 2 cut(s) 594, 648
HpyCH4V TGCA 3 cut(s) 266, 361, 413
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 145, 327
HpySE526I ACGT 2 cut(s) 594, 648
Hsp92I GRCGYC 1 cut(s) 206
Hsp92II CATG 2 cut(s) 477, 767
HspAI GCGC 2 cut(s) 571, 576
KroI GCCGGC 1 cut(s) 219
KroNI GCCGGC 1 cut(s) 221
Ksp22I TGATCA 1 cut(s) 388
Kzo9I GATC 2 cut(s) 388, 521
Lsp1109I GCAGC 1 cut(s) 585
LweI GCATC 4 cut(s) 117, 331, 348, 654
MaeI CTAG 1 cut(s) 323
MaeII ACGT 2 cut(s) 594, 648
MaeIII GTNAC 3 cut(s) 59, 532, 716
MalI GATC 2 cut(s) 390, 523
MboI GATC 2 cut(s) 388, 521
MboII GAAGA 2 cut(s) 292, 479
MflI RGATCY 1 cut(s) 521
MhlI GDGCHC 1 cut(s) 203
MluCI AATT 2 cut(s) 96, 371
MnlI CCTC 7 cut(s) 162, 298, 322, 574, 598, 622, 625
MroNI GCCGGC 1 cut(s) 219
MseI TTAA 3 cut(s) 6, 26, 543
MslI CAYNNNNRTG 1 cut(s) 725
MspI CCGG 2 cut(s) 107, 220
MteI GCGCNGCGC 1 cut(s) 574
MwoI GCNNNNNNNGC 1 cut(s) 212
NaeI GCCGGC 1 cut(s) 221
NdeII GATC 2 cut(s) 388, 521
NgoMIV GCCGGC 1 cut(s) 219
NlaIII CATG 2 cut(s) 477, 767
NmeAIII GCCGAG 1 cut(s) 182
NmuCI GTSAC 2 cut(s) 532, 716
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PdiI GCCGGC 1 cut(s) 221
PfeI GAWTC 1 cut(s) 151
PkrI GCNGC 1 cut(s) 575
Psp1406I AACGTT 1 cut(s) 648
PspFI CCCAGC 1 cut(s) 653
PspPI GGNCC 1 cut(s) 109
PstI CTGCAG 2 cut(s) 268, 415
PsuI RGATCY 1 cut(s) 521
RsaI GTAC 1 cut(s) 528
RsaNI GTAC 1 cut(s) 527
RseI CAYNNNNRTG 1 cut(s) 725
SaqAI TTAA 3 cut(s) 6, 26, 543
SatI GCNGC 1 cut(s) 574
Sau3AI GATC 2 cut(s) 388, 521
Sau96I GGNCC 1 cut(s) 109
SduI GDGCHC 1 cut(s) 203
SetI ASST 9 cut(s) 12, 146, 328, 543, 585, 597, 624, 651, 759
SfaNI GCATC 4 cut(s) 117, 331, 348, 654
SfcI CTRYAG 2 cut(s) 264, 411
SmiMI CAYNNNNRTG 1 cut(s) 725
Sse9I AATT 2 cut(s) 96, 371
SsiI CCGC 1 cut(s) 233
SspMI CTAG 1 cut(s) 323
TaaI ACNGT 7 cut(s) 35, 48, 165, 402, 421, 456, 724
TaiI ACGT 2 cut(s) 597, 651
TaqI TCGA 1 cut(s) 80
TasI AATT 2 cut(s) 96, 371
TatI WGTACW 1 cut(s) 526
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 3 cut(s) 6, 26, 543
Tru9I TTAA 3 cut(s) 6, 26, 543
TscAI CASTG 3 cut(s) 405, 426, 708
TseFI GTSAC 2 cut(s) 532, 716
TseI GCWGC 1 cut(s) 573
Tsp45I GTSAC 2 cut(s) 532, 716
TspDTI ATGAA 1 cut(s) 447
TspRI CASTG 3 cut(s) 405, 426, 708
XagI CCTNNNNNAGG 1 cut(s) 626
XspI CTAG 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.