Rmu_sc0006363.1_g000002

Belongs to the peroxisomal membrane protein PXMP2 4 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006363.1
Physical Location & Seq
Reverse (-)
14947 .. 15546
600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006363.1_g000002.1.cds

Sequence Viewer

Length: 417 bp
atgactccaaaccttgtatcactcactcgtacatccccattcttaaatccttttgtaggaggttgttgttcccgtaaacccattttgcattctaccacgattgcatcaaatcgaattcagacccgttctcactcgtacgctctgaattccggtaatggaataggattccggcaactgcgttttagtccgaaggcggtttccgatgatgggtccaacggaagtgatggtaattctggtggcggaaacaatcatggcagaggtggaggtggaggtggtggcaagggtgatgatagtaattggtctttcctctcatggtatttggatcttcttgcaaagtatcctgcgtccataaaagctctgacatctgcatttttaaccctcattggagatgttatctgccaggtattgttcctctag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

14.47

Weight (kDa)

9.45

Isoelectric Point (pI)

30.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 194, 240
AclWI GGATC 1 cut(s) 330
AcsI RAATTY 2 cut(s) 114, 145
AfaI GTAC 2 cut(s) 31, 137
AfiI CCNNNNNNNGG 2 cut(s) 56, 207
AjnI CCWGG 1 cut(s) 399
AluBI AGCT 1 cut(s) 356
AluI AGCT 1 cut(s) 356
AlwI GGATC 1 cut(s) 330
ApoI RAATTY 2 cut(s) 114, 145
AspS9I GGNCC 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 296
AvaII GGWCC 1 cut(s) 210
BccI CCATC 2 cut(s) 200, 218
BciT130I CCWGG 1 cut(s) 401
BciVI GTATCC 1 cut(s) 348
BfaI CTAG 1 cut(s) 415
BfuI GTATCC 1 cut(s) 348
Bme1390I CCNGG 1 cut(s) 401
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 1 cut(s) 210
BmiI GGNNCC 1 cut(s) 211
BmrFI CCNGG 1 cut(s) 401
BmsI GCATC 1 cut(s) 113
BsaWI WCCGGW 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 207
BseBI CCWGG 1 cut(s) 401
BseGI GGATG 1 cut(s) 32
BseLI CCNNNNNNNGG 2 cut(s) 56, 207
BsiSI CCGG 2 cut(s) 150, 169
BsiWI CGTACG 1 cut(s) 135
BslI CCNNNNNNNGG 2 cut(s) 56, 207
BsmI GAATGC 1 cut(s) 88
Bsp143I GATC 1 cut(s) 322
BspACI CCGC 2 cut(s) 194, 240
BspLI GGNNCC 1 cut(s) 211
BspPI GGATC 1 cut(s) 330
BssMI GATC 1 cut(s) 322
Bst2UI CCWGG 1 cut(s) 401
BstENI CCTNNNNNAGG 1 cut(s) 54
BstF5I GGATG 1 cut(s) 32
BstKTI GATC 1 cut(s) 325
BstMBI GATC 1 cut(s) 322
BstNI CCWGG 1 cut(s) 401
BstSCI CCNGG 1 cut(s) 399
BstX2I RGATCY 1 cut(s) 322
BstYI RGATCY 1 cut(s) 322
BsuI GTATCC 1 cut(s) 348
BtsCI GGATG 1 cut(s) 32
Cfr13I GGNCC 1 cut(s) 210
CseI GACGC 1 cut(s) 333
Csp6I GTAC 2 cut(s) 30, 136
CviAII CATG 2 cut(s) 251, 312
CviJI RGCY 1 cut(s) 356
CviKI_1 RGCY 1 cut(s) 356
CviQI GTAC 2 cut(s) 30, 136
DpnI GATC 1 cut(s) 324
DpnII GATC 1 cut(s) 322
EciI GGCGGA 1 cut(s) 255
Eco47I GGWCC 1 cut(s) 210
EcoNI CCTNNNNNAGG 1 cut(s) 54
EcoRI GAATTC 2 cut(s) 114, 145
EcoRII CCWGG 1 cut(s) 399
FaeI CATG 2 cut(s) 254, 315
FaiI YATR 3 cut(s) 252, 313, 350
FatI CATG 2 cut(s) 250, 311
FokI GGATG 1 cut(s) 19
FspBI CTAG 1 cut(s) 415
HapII CCGG 2 cut(s) 150, 169
HgaI GACGC 1 cut(s) 333
Hin1II CATG 2 cut(s) 254, 315
HinfI GANTC 2 cut(s) 4, 165
HpaII CCGG 2 cut(s) 150, 169
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 1 cut(s) 77
Hpy188I TCNGA 5 cut(s) 120, 144, 189, 202, 360
Hpy8I GTNNAC 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 4 cut(s) 88, 104, 332, 368
Hsp92II CATG 2 cut(s) 254, 315
Kzo9I GATC 1 cut(s) 322
LpnPI CCDG 6 cut(s) 163, 182, 219, 354, 386, 413
LweI GCATC 1 cut(s) 113
MaeI CTAG 1 cut(s) 415
MalI GATC 1 cut(s) 324
MboI GATC 1 cut(s) 322
MboII GAAGA 1 cut(s) 317
MflI RGATCY 1 cut(s) 322
MluCI AATT 4 cut(s) 114, 145, 229, 295
MmeI TCCRAC 1 cut(s) 237
MnlI CCTC 6 cut(s) 53, 251, 257, 263, 317, 389
MseI TTAA 2 cut(s) 44, 374
MspI CCGG 2 cut(s) 150, 169
MspR9I CCNGG 1 cut(s) 401
Mva1269I GAATGC 1 cut(s) 88
MvaI CCWGG 1 cut(s) 401
NdeII GATC 1 cut(s) 322
NlaIII CATG 2 cut(s) 254, 315
NlaIV GGNNCC 1 cut(s) 211
PctI GAATGC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 165
Pfl23II CGTACG 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 399
PspGI CCWGG 1 cut(s) 399
PspLI CGTACG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 211
PspPI GGNCC 1 cut(s) 210
PsuI RGATCY 1 cut(s) 322
RsaI GTAC 2 cut(s) 31, 137
RsaNI GTAC 2 cut(s) 30, 136
SaqAI TTAA 2 cut(s) 44, 374
Sau3AI GATC 1 cut(s) 322
Sau96I GGNCC 1 cut(s) 210
ScrFI CCNGG 1 cut(s) 401
SetI ASST 7 cut(s) 15, 64, 262, 268, 274, 358, 405
SfaNI GCATC 1 cut(s) 113
SinI GGWCC 1 cut(s) 210
Sse9I AATT 4 cut(s) 114, 145, 229, 295
SsiI CCGC 2 cut(s) 194, 240
SspMI CTAG 1 cut(s) 415
StyD4I CCNGG 1 cut(s) 399
TaqI TCGA 1 cut(s) 112
TasI AATT 4 cut(s) 114, 145, 229, 295
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 2 cut(s) 44, 374
Tru9I TTAA 2 cut(s) 44, 374
TspGWI ACGGA 1 cut(s) 231
VpaK11BI GGWCC 1 cut(s) 210
XagI CCTNNNNNAGG 1 cut(s) 54
XapI RAATTY 2 cut(s) 114, 145
XspI CTAG 1 cut(s) 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.