Rmu_sc0007103.1_g000012

protein membrane anchor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007103.1
Physical Location & Seq
Reverse (-)
62662 .. 64823
2162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007103.1_g000012.1.cds

Sequence Viewer

Length: 462 bp
atgggtgattcttcatcatcatcatcatcagtctcacctcagtttgttacaaagcattgggagggcttcaaggagttctggggggagaggttctccttcctcgaccactattccaagttcatcaagcgtgataagcctcttccttcttggtctgacgctgatgttgaagcattcattgctactgatccagttcatggccccgctctgaagactgctagggaagcagcgaaatttgctgttacaggaagtgttattggagcagtatcaactgctggagttgcatggaaatattcaaggagtttgcatggttctggactggcgtttttagctggaggtgtctttggttggacatttggacaggaaattgcaaaccactcacttcaattgtacaggttcgacaccttggctgcacaaactaagttcttggaatggtgggaagacaagagtgagcgacagtcttaa

Protein Analysis

153

Amino Acids

16.99

Weight (kDa)

6.51

Isoelectric Point (pI)

37.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 194
AccBSI CCGCTC 1 cut(s) 203
AciI CCGC 1 cut(s) 201
AclWI GGATC 1 cut(s) 179
AcsI RAATTY 1 cut(s) 230
AcuI CTGAAG 1 cut(s) 227
AfaI GTAC 1 cut(s) 389
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 4 cut(s) 70, 167, 294, 383
AluBI AGCT 1 cut(s) 329
AluI AGCT 1 cut(s) 329
Alw26I GTCTC 1 cut(s) 37
AlwI GGATC 1 cut(s) 179
AoxI GGCC 1 cut(s) 196
ApeKI GCWGC 2 cut(s) 224, 407
ApoI RAATTY 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 197
AsuHPI GGTGA 2 cut(s) 17, 27
BbsI GAAGAC 2 cut(s) 215, 444
BbvI GCAGC 2 cut(s) 236, 394
BcoDI GTCTC 1 cut(s) 37
BfaI CTAG 1 cut(s) 216
BisI GCNGC 2 cut(s) 225, 408
BlsI GCNGC 2 cut(s) 226, 409
BmgT120I GGNCC 1 cut(s) 197
BmiI GGNNCC 1 cut(s) 199
BpiI GAAGAC 2 cut(s) 215, 444
BplI GAGNNNNNCTC 2 cut(s) 77, 109
BpmI CTGGAG 2 cut(s) 294, 351
BsaJI CCNNGG 1 cut(s) 402
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 2 cut(s) 188, 321
Bse3DI GCAATG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 402
BseLI CCNNNNNNNGG 1 cut(s) 194
BseMI GCAATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 53
BseNI ACTGG 2 cut(s) 188, 321
BseXI GCAGC 2 cut(s) 236, 394
BsgI GTGCAG 1 cut(s) 393
BshFI GGCC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 37
BsmI GAATGC 1 cut(s) 170
BsnI GGCC 1 cut(s) 198
Bsp1407I TGTACA 1 cut(s) 387
Bsp143I GATC 1 cut(s) 184
BspACI CCGC 1 cut(s) 201
BspANI GGCC 1 cut(s) 198
BspCNI CTCAG 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 199
BspPI GGATC 1 cut(s) 179
BsrBI CCGCTC 1 cut(s) 203
BsrDI GCAATG 1 cut(s) 174
BsrGI TGTACA 1 cut(s) 387
BsrI ACTGG 2 cut(s) 188, 321
BssECI CCNNGG 1 cut(s) 402
BssMI GATC 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 402
Bst4CI ACNGT 1 cut(s) 456
Bst6I CTCTTC 1 cut(s) 144
BstAPI GCANNNNNTGC 1 cut(s) 176
BstAUI TGTACA 1 cut(s) 387
BstDEI CTNAG 2 cut(s) 39, 417
BstKTI GATC 1 cut(s) 187
BstMAI GTCTC 1 cut(s) 37
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 6 cut(s) 133, 176, 221, 233, 278, 326
BstV1I GCAGC 2 cut(s) 236, 394
BstV2I GAAGAC 2 cut(s) 215, 444
BsuRI GGCC 1 cut(s) 198
Cfr13I GGNCC 1 cut(s) 197
CseI GACGC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 388
CviAII CATG 3 cut(s) 194, 282, 305
CviJI RGCY 5 cut(s) 66, 136, 198, 329, 407
CviKI_1 RGCY 5 cut(s) 66, 136, 198, 329, 407
CviQI GTAC 1 cut(s) 388
DdeI CTNAG 2 cut(s) 39, 417
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eam1104I CTCTTC 1 cut(s) 144
EarI CTCTTC 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 402
Eco57I CTGAAG 1 cut(s) 227
EcoT14I CCWWGG 1 cut(s) 402
ErhI CCWWGG 1 cut(s) 402
FaeI CATG 3 cut(s) 197, 285, 308
FaiI YATR 3 cut(s) 195, 283, 306
FatI CATG 3 cut(s) 193, 281, 304
FauI CCCGC 1 cut(s) 208
Fnu4HI GCNGC 2 cut(s) 225, 408
Fsp4HI GCNGC 2 cut(s) 225, 408
FspBI CTAG 1 cut(s) 216
GluI GCNGC 2 cut(s) 225, 408
GsuI CTGGAG 2 cut(s) 294, 351
HaeIII GGCC 1 cut(s) 198
HgaI GACGC 1 cut(s) 164
Hin1II CATG 3 cut(s) 197, 285, 308
HinfI GANTC 1 cut(s) 8
HphI GGTGA 2 cut(s) 17, 27
Hpy188I TCNGA 2 cut(s) 154, 207
Hpy188III TCNNGA 1 cut(s) 312
HpyAV CCTTC 2 cut(s) 106, 153
HpyCH4III ACNGT 1 cut(s) 456
HpyCH4V TGCA 4 cut(s) 281, 304, 368, 410
HpyF10VI GCNNNNNNNGC 6 cut(s) 133, 176, 221, 233, 278, 326
HpyF3I CTNAG 2 cut(s) 39, 417
Hsp92II CATG 3 cut(s) 197, 285, 308
Kzo9I GATC 1 cut(s) 184
LmnI GCTCC 1 cut(s) 257
LpnPI CCDG 9 cut(s) 64, 201, 228, 258, 297, 302, 315, 344, 376
Lsp1109I GCAGC 2 cut(s) 236, 394
MaeI CTAG 1 cut(s) 216
MaeIII GTNAC 2 cut(s) 46, 238
MalI GATC 1 cut(s) 186
MbiI CCGCTC 1 cut(s) 203
MboI GATC 1 cut(s) 184
MboII GAAGA 4 cut(s) 3, 131, 220, 449
MfeI CAATTG 1 cut(s) 383
MluCI AATT 3 cut(s) 230, 363, 383
MmeI TCCRAC 1 cut(s) 326
MnlI CCTC 6 cut(s) 48, 55, 81, 110, 147, 326
MseI TTAA 1 cut(s) 460
MunI CAATTG 1 cut(s) 383
Mva1269I GAATGC 1 cut(s) 170
MwoI GCNNNNNNNGC 6 cut(s) 133, 176, 221, 233, 278, 326
NdeII GATC 1 cut(s) 184
NlaIII CATG 3 cut(s) 197, 285, 308
NlaIV GGNNCC 1 cut(s) 199
PctI GAATGC 1 cut(s) 170
PfeI GAWTC 1 cut(s) 8
PflMI CCANNNNNTGG 1 cut(s) 194
PkrI GCNGC 2 cut(s) 226, 409
PspN4I GGNNCC 1 cut(s) 199
PspPI GGNCC 1 cut(s) 197
RsaI GTAC 1 cut(s) 389
RsaNI GTAC 1 cut(s) 388
SaqAI TTAA 1 cut(s) 460
SatI GCNGC 2 cut(s) 225, 408
Sau3AI GATC 1 cut(s) 184
Sau96I GGNCC 1 cut(s) 197
SetI ASST 6 cut(s) 40, 92, 331, 337, 395, 404
Sse9I AATT 3 cut(s) 230, 363, 383
SsiI CCGC 1 cut(s) 201
SspI AATATT 1 cut(s) 290
SspMI CTAG 1 cut(s) 216
StyI CCWWGG 1 cut(s) 402
TaaI ACNGT 1 cut(s) 456
TaqI TCGA 2 cut(s) 102, 396
TasI AATT 3 cut(s) 230, 363, 383
TatI WGTACW 1 cut(s) 387
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 460
Tru9I TTAA 1 cut(s) 460
TseI GCWGC 2 cut(s) 224, 407
TspDTI ATGAA 3 cut(s) 109, 163, 182
Van91I CCANNNNNTGG 1 cut(s) 194
XapI RAATTY 1 cut(s) 230
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.