Rmu_sc0007154.1_g000010

leucine-rich repeat receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007154.1
OG0015232
Physical Location & Seq
Forward (+)
28459 .. 30991
2533 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1116 bp
atgtcatgtcttgcatgtgagggtgtcccggaggagcgaatcagggagattttggccgctttggatattcaccatattcatcatgttccaagggcggctaacaaggcggctcatactgttgcaggagttgtaacccgaggaaggagagtggggagttcatgtccaccaccagtcatttccatgctttgtaatcttgataatctttggcgtttttggcctgcaagatgttcttattgcttgaatatcagaagacgccaaggagtggtttataaagctgatctggttgtcattggaatctttgttggtgtagcccatggaattttgatagctgcactcatatttttcagaataaaggtgtggaataatcacaacaaagatggatttcctactgcatcaggtgtacttagatactcttacaagtatgcattaaatgctgtatcatttagggatgtacagaaagctacacagaacttcgcaaccatttggggacaaggggcttttggtccagtcaataaagcaacaatgcctgctggaaaggtagcagctgtgaaggtgcttgcttcaaattccaagcagggagagaaagagttccagacagaggaaaagactacatcagctacatttcgaataggtatctctgttaggaagactgcatcatcaaaatctagtgaacctcataggtatcactacaatgttttggatgtgagagtggactggcacattgacaaaggaaaggaagatggtttgtatattagctgtgtcgcctcatctgtgaatatgtgggctgtagtcatggatgcagggacaggtttcacatcccaactttatgaactattcacctgtttacttgcaggaggagtggataatggaacagtgggacaagaactaccatatcacttcacttgctggcgcaggcaatggcagtgccttggtggtaatgtccaaaggcctaccatatactcagcagttgtagcagatggggcattgtcatgtccagaaatgcaggttattctaatcaggttgttgagattgatttcctatatcccagcgaaggcatccatggaagatgggagaatggatatcgcatttacctcaactgctgcaacagaggattaa

Protein Analysis

371

Amino Acids

40.93

Weight (kDa)

9.15

Isoelectric Point (pI)

47.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7477 PF24289 190 - 283 4.4e-24 Domain of unknown function (DUF7477)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 270
Acc36I ACCTGC 1 cut(s) 994
AccB7I CCANNNNNTGG 1 cut(s) 262
AciI CCGC 3 cut(s) 57, 95, 107
AcoI YGGCCR 1 cut(s) 54
AcsI RAATTY 2 cut(s) 318, 565
AcyI GRCGYC 1 cut(s) 253
AfaI GTAC 2 cut(s) 402, 453
AfiI CCNNNNNNNGG 4 cut(s) 141, 262, 598, 1051
AgsI TTSAA 2 cut(s) 241, 564
AluBI AGCT 6 cut(s) 275, 329, 461, 545, 617, 756
AluI AGCT 6 cut(s) 275, 329, 461, 545, 617, 756
Ama87I CYCGRG 1 cut(s) 135
AoxI GGCC 3 cut(s) 54, 215, 947
ApeKI GCWGC 3 cut(s) 329, 542, 1100
ApoI RAATTY 2 cut(s) 318, 565
Asp700I GAANNNNTTC 1 cut(s) 587
AspLEI GCGC 1 cut(s) 912
AspS9I GGNCC 1 cut(s) 503
AsuC2I CCSGG 1 cut(s) 29
AsuHPI GGTGA 2 cut(s) 62, 829
AsuII TTCGAA 1 cut(s) 625
AvaI CYCGRG 1 cut(s) 135
AvaII GGWCC 1 cut(s) 503
BbsI GAAGAC 2 cut(s) 256, 653
BbvI GCAGC 3 cut(s) 316, 554, 1087
BccI CCATC 4 cut(s) 371, 734, 971, 1061
BcnI CCSGG 1 cut(s) 29
BfaI CTAG 1 cut(s) 666
BfmI CTRYAG 1 cut(s) 786
BfuAI ACCTGC 1 cut(s) 994
BisI GCNGC 6 cut(s) 57, 96, 108, 330, 543, 1101
BlsI GCNGC 6 cut(s) 58, 97, 109, 331, 544, 1102
Bme1390I CCNGG 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 503
BmeT110I CYCGRG 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 503
BmrFI CCNGG 1 cut(s) 29
BmsI GCATC 4 cut(s) 401, 662, 787, 1064
BpiI GAAGAC 2 cut(s) 256, 653
Bpu14I TTCGAA 1 cut(s) 625
BpuMI CCSGG 1 cut(s) 29
BsaHI GRCGYC 1 cut(s) 253
BsaJI CCNNGG 6 cut(s) 89, 136, 256, 313, 928, 1059
BsaXI ACNNNNNCTCC 2 cut(s) 145, 175
Bsc4I CCNNNNNNNGG 4 cut(s) 141, 262, 598, 1051
Bse1I ACTGG 3 cut(s) 170, 506, 719
Bse3DI GCAATG 1 cut(s) 923
BseDI CCNNGG 6 cut(s) 89, 136, 256, 313, 928, 1059
BseGI GGATG 5 cut(s) 454, 706, 802, 815, 1055
BseLI CCNNNNNNNGG 4 cut(s) 141, 262, 598, 1051
BseMI GCAATG 1 cut(s) 923
BseMII CTCAG 1 cut(s) 975
BseNI ACTGG 3 cut(s) 170, 506, 719
BseRI GAGGAG 2 cut(s) 47, 870
BseXI GCAGC 3 cut(s) 316, 554, 1087
BseYI CCCAGC 1 cut(s) 1045
BsgI GTGCAG 1 cut(s) 315
BshFI GGCC 3 cut(s) 56, 217, 949
BsiHKCI CYCGRG 1 cut(s) 135
BsiSI CCGG 1 cut(s) 29
BslFI GGGAC 4 cut(s) 11, 501, 817, 891
BslI CCNNNNNNNGG 4 cut(s) 141, 262, 598, 1051
BsmFI GGGAC 4 cut(s) 11, 501, 817, 891
BsnI GGCC 3 cut(s) 56, 217, 949
BsoBI CYCGRG 1 cut(s) 135
Bsp119I TTCGAA 1 cut(s) 625
Bsp1407I TGTACA 1 cut(s) 451
Bsp143I GATC 1 cut(s) 277
Bsp19I CCATGG 2 cut(s) 313, 1059
BspACI CCGC 3 cut(s) 57, 95, 107
BspANI GGCC 3 cut(s) 56, 217, 949
BspCNI CTCAG 1 cut(s) 974
BspMI ACCTGC 1 cut(s) 994
BspT104I TTCGAA 1 cut(s) 625
BsrDI GCAATG 1 cut(s) 923
BsrGI TGTACA 1 cut(s) 451
BsrI ACTGG 3 cut(s) 170, 506, 719
BssECI CCNNGG 6 cut(s) 89, 136, 256, 313, 928, 1059
BssMI GATC 1 cut(s) 277
BssNI GRCGYC 1 cut(s) 253
BssT1I CCWWGG 5 cut(s) 89, 256, 313, 928, 1059
Bst4CI ACNGT 2 cut(s) 118, 874
BstACI GRCGYC 1 cut(s) 253
BstAPI GCANNNNNTGC 1 cut(s) 431
BstAUI TGTACA 1 cut(s) 451
BstBI TTCGAA 1 cut(s) 625
BstC8I GCNNGC 5 cut(s) 219, 528, 558, 908, 914
BstDEI CTNAG 2 cut(s) 404, 961
BstDSI CCRYGG 2 cut(s) 313, 1059
BstF5I GGATG 5 cut(s) 454, 706, 802, 815, 1055
BstHHI GCGC 1 cut(s) 912
BstKTI GATC 1 cut(s) 280
BstMBI GATC 1 cut(s) 277
BstMWI GCNNNNNNNGC 5 cut(s) 104, 214, 431, 971, 980
BstNSI RCATGY 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 27
BstSFI CTRYAG 1 cut(s) 786
BstV1I GCAGC 3 cut(s) 316, 554, 1087
BstV2I GAAGAC 2 cut(s) 256, 653
BsuRI GGCC 3 cut(s) 56, 217, 949
BtgI CCRYGG 2 cut(s) 313, 1059
BtsCI GGATG 5 cut(s) 454, 706, 802, 815, 1055
BtsI GCAGTG 1 cut(s) 929
BtsIMutI CAGTG 2 cut(s) 879, 929
BveI ACCTGC 1 cut(s) 994
Cac8I GCNNGC 5 cut(s) 219, 528, 558, 908, 914
CfoI GCGC 1 cut(s) 912
Cfr13I GGNCC 1 cut(s) 503
CseI GACGC 1 cut(s) 261
Csp6I GTAC 2 cut(s) 401, 452
CviAII CATG 9 cut(s) 6, 15, 83, 159, 181, 314, 793, 990, 1060
CviQI GTAC 2 cut(s) 401, 452
DdeI CTNAG 2 cut(s) 404, 961
DpnI GATC 1 cut(s) 279
DpnII GATC 1 cut(s) 277
EaeI YGGCCR 1 cut(s) 54
Eco130I CCWWGG 5 cut(s) 89, 256, 313, 928, 1059
Eco147I AGGCCT 1 cut(s) 949
Eco32I GATATC 1 cut(s) 1081
Eco47I GGWCC 1 cut(s) 503
Eco88I CYCGRG 1 cut(s) 135
EcoRV GATATC 1 cut(s) 1081
EcoT14I CCWWGG 5 cut(s) 89, 256, 313, 928, 1059
EcoT22I ATGCAT 1 cut(s) 427
ErhI CCWWGG 5 cut(s) 89, 256, 313, 928, 1059
FaeI CATG 9 cut(s) 9, 18, 86, 162, 184, 317, 796, 993, 1063
FalI AAGNNNNNCTT 2 cut(s) 214, 246
FaqI GGGAC 4 cut(s) 11, 501, 817, 891
FatI CATG 9 cut(s) 5, 14, 82, 158, 180, 313, 792, 989, 1059
Fnu4HI GCNGC 6 cut(s) 57, 96, 108, 330, 543, 1101
FokI GGATG 5 cut(s) 461, 713, 802, 809, 1042
Fsp4HI GCNGC 6 cut(s) 57, 96, 108, 330, 543, 1101
FspBI CTAG 1 cut(s) 666
GlaI GCGC 1 cut(s) 911
GluI GCNGC 6 cut(s) 57, 96, 108, 330, 543, 1101
GsaI CCCAGC 1 cut(s) 1049
HaeIII GGCC 3 cut(s) 56, 217, 949
HapII CCGG 1 cut(s) 29
HgaI GACGC 1 cut(s) 261
HhaI GCGC 1 cut(s) 912
Hin1I GRCGYC 1 cut(s) 253
Hin1II CATG 9 cut(s) 9, 18, 86, 162, 184, 317, 796, 993, 1063
Hin6I GCGC 1 cut(s) 910
HinP1I GCGC 1 cut(s) 910
HinfI GANTC 2 cut(s) 39, 294
HpaII CCGG 1 cut(s) 29
HphI GGTGA 2 cut(s) 62, 829
Hpy166II GTNNAC 5 cut(s) 164, 401, 671, 712, 845
Hpy188I TCNGA 2 cut(s) 248, 347
Hpy188III TCNNGA 3 cut(s) 194, 592, 995
Hpy8I GTNNAC 5 cut(s) 164, 401, 671, 712, 845
HpyAV CCTTC 3 cut(s) 135, 544, 1045
HpyCH4III ACNGT 2 cut(s) 118, 874
HpyF10VI GCNNNNNNNGC 5 cut(s) 104, 214, 431, 971, 980
HpyF3I CTNAG 2 cut(s) 404, 961
Hsp92I GRCGYC 1 cut(s) 253
Hsp92II CATG 9 cut(s) 9, 18, 86, 162, 184, 317, 796, 993, 1063
HspAI GCGC 1 cut(s) 910
Kzo9I GATC 1 cut(s) 277
LmnI GCTCC 1 cut(s) 34
Lsp1109I GCAGC 3 cut(s) 316, 554, 1087
LweI GCATC 4 cut(s) 401, 662, 787, 1064
MaeI CTAG 1 cut(s) 666
MaeIII GTNAC 1 cut(s) 130
MalI GATC 1 cut(s) 279
MboI GATC 1 cut(s) 277
MboII GAAGA 4 cut(s) 261, 658, 749, 1076
MluCI AATT 2 cut(s) 318, 565
MnlI CCTC 9 cut(s) 13, 25, 131, 592, 684, 775, 848, 1102, 1102
Mph1103I ATGCAT 1 cut(s) 427
MroXI GAANNNNTTC 1 cut(s) 587
MseI TTAA 2 cut(s) 428, 1114
MslI CAYNNNNRTG 3 cut(s) 179, 690, 988
MspA1I CMGCKG 1 cut(s) 545
MspI CCGG 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 29
MwoI GCNNNNNNNGC 5 cut(s) 104, 214, 431, 971, 980
NciI CCSGG 1 cut(s) 29
NcoI CCATGG 2 cut(s) 313, 1059
NdeII GATC 1 cut(s) 277
NlaIII CATG 9 cut(s) 9, 18, 86, 162, 184, 317, 796, 993, 1063
NsiI ATGCAT 1 cut(s) 427
NspI RCATGY 1 cut(s) 18
NspV TTCGAA 1 cut(s) 625
PceI AGGCCT 1 cut(s) 949
PdmI GAANNNNTTC 1 cut(s) 587
PfeI GAWTC 2 cut(s) 39, 294
PflMI CCANNNNNTGG 1 cut(s) 262
PfoI TCCNGGA 1 cut(s) 27
PkrI GCNGC 6 cut(s) 58, 97, 109, 331, 544, 1102
PsiI TTATAA 1 cut(s) 270
PspFI CCCAGC 1 cut(s) 1045
PspPI GGNCC 1 cut(s) 503
PvuII CAGCTG 1 cut(s) 545
RsaI GTAC 2 cut(s) 402, 453
RsaNI GTAC 2 cut(s) 401, 452
RseI CAYNNNNRTG 3 cut(s) 179, 690, 988
SaqAI TTAA 2 cut(s) 428, 1114
SatI GCNGC 6 cut(s) 57, 96, 108, 330, 543, 1101
Sau3AI GATC 1 cut(s) 277
Sau96I GGNCC 1 cut(s) 503
ScrFI CCNGG 1 cut(s) 29
SfaNI GCATC 4 cut(s) 401, 662, 787, 1064
SfcI CTRYAG 1 cut(s) 786
SfuI TTCGAA 1 cut(s) 625
SinI GGWCC 1 cut(s) 503
SmiMI CAYNNNNRTG 3 cut(s) 179, 690, 988
Sse9I AATT 2 cut(s) 318, 565
SseBI AGGCCT 1 cut(s) 949
SsiI CCGC 3 cut(s) 57, 95, 107
SspMI CTAG 1 cut(s) 666
StuI AGGCCT 1 cut(s) 949
StyD4I CCNGG 1 cut(s) 27
StyI CCWWGG 5 cut(s) 89, 256, 313, 928, 1059
TaaI ACNGT 2 cut(s) 118, 874
TaqI TCGA 1 cut(s) 625
TasI AATT 2 cut(s) 318, 565
TatI WGTACW 2 cut(s) 400, 451
TauI GCSGC 3 cut(s) 59, 98, 110
TfiI GAWTC 2 cut(s) 39, 294
Tru1I TTAA 2 cut(s) 428, 1114
Tru9I TTAA 2 cut(s) 428, 1114
TscAI CASTG 2 cut(s) 879, 929
TseI GCWGC 3 cut(s) 329, 542, 1100
TspDTI ATGAA 3 cut(s) 68, 147, 843
TspRI CASTG 2 cut(s) 879, 929
Van91I CCANNNNNTGG 1 cut(s) 262
VpaK11BI GGWCC 1 cut(s) 503
XapI RAATTY 2 cut(s) 318, 565
XceI RCATGY 1 cut(s) 18
XmnI GAANNNNTTC 1 cut(s) 587
XspI CTAG 1 cut(s) 666
Zsp2I ATGCAT 1 cut(s) 427
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.