Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007360.1

Orthogroup ID

OG0006549

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 829

Gene Structure 829 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007360.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

atgtcctcccccaaattcctctcaatccccacaactctcaccttaactatcaacttatcctcatccctaaacccacccagaaccccatccttcttcccaaaccccacattaactctcagactccaccttacccaaaaccccaagaacccatttttccacaccccctccaaaacccatctccaccttcaccatcccctgctcgccgcaccacccagcagccctgcgcccccgcctgaccaccaatcggagcaagtcttggctgcccaagaagctatcttggagtttcttcaagaacttggggtttctgaggaggaagcaatctttgtttcttcaaattcgcctagatatatgcgggtgttggtggatggggtccaggagttggatgagcttggggtgtggagagagcagttggttgggtttaaagagaaggtcaagtatttggctaaggagaaaggtgacaatggcaaggttgcgtttttggagagtgtggttgggttgggtctatcttcggctatgaatattgcaaggcattcgtcggcagagactctacctgggctcattgacaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

mTERF

Protein Analysis

189

Amino Acids

20.75

Weight (kDa)

6.23

Isoelectric Point (pI)

53.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006549)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G78930
fragaria_vesca	FvH4_4g20560 FvH4_6g36600
malus_domestica	MD09G1167200.v1.1 MD09G1167300.v1.1 MD17G1161200.v1.1
prunus_persica	Prupe.3G025200_v2.0.a1 Prupe.3G025200_v2.0.a1 Prupe.3G025200_v2.0.a1 Prupe.3G025200_v2.0.a1 Prupe.3G025200_v2.0.a1 Prupe.3G025200_v2.0.a1
pyrus_communis	pycom09g08480 pycom17g15380
rosa_chinensis	RchiOBHm_Chr2g0149071
rosa_laevigata	RLG00000020366
rosa_multiflora	Rmu_sc0002345.1_g000001 Rmu_sc0007360.1_g000001 Rmu_sc0034832.1_g000001
rosa_roxburghii	Rroxscaffold_2G00098500
rosa_rugosa	Rorug02G0409100
rosa_samantha	Rh2AG468400 Rh2BG481100 Rh2CG454600 Rh2DG489900
rosa_wichuraiana	Rw2G038150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	379
AciI	CCGC	3 cut(s)	204, 230, 352
AcsI	RAATTY	2 cut(s)	14, 334
AfiI	CCNNNNNNNGG	2 cut(s)	244, 379
AgsI	TTSAA	2 cut(s)	290, 333
AjnI	CCWGG	2 cut(s)	372, 550
AluBI	AGCT	2 cut(s)	272, 388
AluI	AGCT	2 cut(s)	272, 388
Alw26I	GTCTC	1 cut(s)	536
ApeKI	GCWGC	2 cut(s)	216, 260
ApoI	RAATTY	2 cut(s)	14, 334
AspLEI	GCGC	1 cut(s)	226
AspS9I	GGNCC	1 cut(s)	370
AsuHPI	GGTGA	3 cut(s)	31, 179, 467
AvaII	GGWCC	1 cut(s)	370
BanII	GRGCYC	1 cut(s)	558
BbvI	GCAGC	2 cut(s)	228, 247
BccI	CCATC	4 cut(s)	94, 183, 198, 359
BcgI	CGANNNNNNTGC	2 cut(s)	513, 547
BciT130I	CCWGG	2 cut(s)	374, 552
BcoDI	GTCTC	1 cut(s)	536
BfaI	CTAG	1 cut(s)	342
BisI	GCNGC	3 cut(s)	204, 217, 261
BlsI	GCNGC	3 cut(s)	205, 218, 262
Bme1390I	CCNGG	2 cut(s)	374, 552
Bme18I	GGWCC	1 cut(s)	370
BmgT120I	GGNCC	1 cut(s)	370
BmiI	GGNNCC	1 cut(s)	371
BmrFI	CCNGG	2 cut(s)	374, 552
Bpu10I	CCTNAGC	1 cut(s)	444
BsaJI	CCNNGG	1 cut(s)	551
BsaXI	ACNNNNNCTCC	2 cut(s)	149, 179
Bsc4I	CCNNNNNNNGG	2 cut(s)	244, 379
BseBI	CCWGG	2 cut(s)	374, 552
BseDI	CCNNGG	1 cut(s)	551
BseGI	GGATG	5 cut(s)	62, 86, 190, 370, 388
BseLI	CCNNNNNNNGG	2 cut(s)	244, 379
BseMII	CTCAG	2 cut(s)	130, 297
BseRI	GAGGAG	1 cut(s)	323
BseXI	GCAGC	2 cut(s)	228, 247
BseYI	CCCAGC	1 cut(s)	212
BslI	CCNNNNNNNGG	2 cut(s)	244, 379
BsmAI	GTCTC	1 cut(s)	536
BsmI	GAATGC	1 cut(s)	529
Bsp1286I	GDGCHC	1 cut(s)	558
BspACI	CCGC	3 cut(s)	204, 230, 352
BspCNI	CTCAG	2 cut(s)	129, 298
BspLI	GGNNCC	1 cut(s)	371
BssECI	CCNNGG	1 cut(s)	551
Bst2UI	CCWGG	2 cut(s)	374, 552
BstC8I	GCNNGC	1 cut(s)	201
BstDEI	CTNAG	3 cut(s)	116, 306, 444
BstF5I	GGATG	5 cut(s)	62, 86, 190, 370, 388
BstHHI	GCGC	1 cut(s)	226
BstMAI	GTCTC	1 cut(s)	536
BstMWI	GCNNNNNNNGC	1 cut(s)	269
BstNI	CCWGG	2 cut(s)	374, 552
BstSCI	CCNGG	2 cut(s)	372, 550
BstV1I	GCAGC	2 cut(s)	228, 247
BtsCI	GGATG	5 cut(s)	62, 86, 190, 370, 388
Cac8I	GCNNGC	1 cut(s)	201
CfoI	GCGC	1 cut(s)	226
Cfr13I	GGNCC	1 cut(s)	370
CviJI	RGCY	7 cut(s)	219, 260, 272, 388, 443, 512, 556
CviKI_1	RGCY	7 cut(s)	219, 260, 272, 388, 443, 512, 556
DdeI	CTNAG	3 cut(s)	116, 306, 444
DraI	TTTAAA	1 cut(s)	421
Eco24I	GRGCYC	1 cut(s)	558
Eco47I	GGWCC	1 cut(s)	370
EcoRII	CCWGG	2 cut(s)	372, 550
EcoT38I	GRGCYC	1 cut(s)	558
FaiI	YATR	3 cut(s)	348, 350, 515
FauI	CCCGC	2 cut(s)	237, 345
Fnu4HI	GCNGC	3 cut(s)	204, 217, 261
FokI	GGATG	5 cut(s)	49, 73, 177, 377, 395
FriOI	GRGCYC	1 cut(s)	558
Fsp4HI	GCNGC	3 cut(s)	204, 217, 261
FspBI	CTAG	1 cut(s)	342
GlaI	GCGC	1 cut(s)	225
GluI	GCNGC	3 cut(s)	204, 217, 261
GsaI	CCCAGC	1 cut(s)	216
HhaI	GCGC	1 cut(s)	226
Hin6I	GCGC	1 cut(s)	224
HinP1I	GCGC	1 cut(s)	224
HinfI	GANTC	2 cut(s)	120, 544
HphI	GGTGA	3 cut(s)	31, 179, 467
Hpy188I	TCNGA	3 cut(s)	119, 247, 307
Hpy188III	TCNNGA	1 cut(s)	290
Hpy99I	CGWCG	1 cut(s)	538
HpyAV	CCTTC	3 cut(s)	100, 194, 421
HpyCH4V	TGCA	1 cut(s)	524
HpyF10VI	GCNNNNNNNGC	1 cut(s)	269
HpyF3I	CTNAG	3 cut(s)	116, 306, 444
HspAI	GCGC	1 cut(s)	224
LmnI	GCTCC	1 cut(s)	247
LpnPI	CCDG	8 cut(s)	91, 209, 226, 234, 246, 359, 386, 537
Lsp1109I	GCAGC	2 cut(s)	228, 247
MaeI	CTAG	1 cut(s)	342
MaeIII	GTNAC	1 cut(s)	455
MboII	GAAGA	4 cut(s)	85, 278, 321, 498
MhlI	GDGCHC	1 cut(s)	558
MluCI	AATT	2 cut(s)	14, 334
MlyI	GAGTC	2 cut(s)	114, 538
MmeI	TCCRAC	1 cut(s)	360
MnlI	CCTC	6 cut(s)	16, 29, 70, 175, 301, 304
MseI	TTAA	3 cut(s)	44, 110, 420
MspR9I	CCNGG	2 cut(s)	374, 552
Mva1269I	GAATGC	1 cut(s)	529
MvaI	CCWGG	2 cut(s)	374, 552
MwoI	GCNNNNNNNGC	1 cut(s)	269
NlaIV	GGNNCC	1 cut(s)	371
NmuCI	GTSAC	1 cut(s)	455
PctI	GAATGC	1 cut(s)	529
PflMI	CCANNNNNTGG	1 cut(s)	379
PfoI	TCCNGGA	1 cut(s)	372
PkrI	GCNGC	3 cut(s)	205, 218, 262
PleI	GAGTC	2 cut(s)	114, 538
PpsI	GAGTC	2 cut(s)	114, 538
Psp6I	CCWGG	2 cut(s)	372, 550
PspFI	CCCAGC	1 cut(s)	212
PspGI	CCWGG	2 cut(s)	372, 550
PspN4I	GGNNCC	1 cut(s)	371
PspPI	GGNCC	1 cut(s)	370
SaqAI	TTAA	3 cut(s)	44, 110, 420
SatI	GCNGC	3 cut(s)	204, 217, 261
Sau96I	GGNCC	1 cut(s)	370
SchI	GAGTC	2 cut(s)	114, 538
ScrFI	CCNGG	2 cut(s)	374, 552
SduI	GDGCHC	1 cut(s)	558
SetI	ASST	9 cut(s)	44, 129, 186, 274, 390, 432, 457, 471, 553
SinI	GGWCC	1 cut(s)	370
Sse9I	AATT	2 cut(s)	14, 334
SsiI	CCGC	3 cut(s)	204, 230, 352
SspI	AATATT	1 cut(s)	520
SspMI	CTAG	1 cut(s)	342
StyD4I	CCNGG	2 cut(s)	372, 550
TasI	AATT	2 cut(s)	14, 334
TauI	GCSGC	1 cut(s)	206
Tru1I	TTAA	3 cut(s)	44, 110, 420
Tru9I	TTAA	3 cut(s)	44, 110, 420
TseFI	GTSAC	1 cut(s)	455
TseI	GCWGC	2 cut(s)	216, 260
Tsp45I	GTSAC	1 cut(s)	455
TspDTI	ATGAA	1 cut(s)	530
Van91I	CCANNNNNTGG	1 cut(s)	379
VpaK11BI	GGWCC	1 cut(s)	370
XapI	RAATTY	2 cut(s)	14, 334
XspI	CTAG	1 cut(s)	342

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.