Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007612.1

Orthogroup ID

OG0010743

Physical Location & Seq

Genomic Coordinates Forward (+)

122202 .. 124574

Gene Structure 2373 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007612.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atgcaaatcactaatggcttcttcgatatttgcaaccgagagacgggcctacggcgacccagacgctttgctcgtcagttctctgctaaccagagcatcgtaaagcaattagatatgtatggggaattaaaggggcataacgattatgtaagctccatagaattcaactccattggtgacctccttgtgtcagggtcttatgataaacaagtcatattttggaactgggaaactaaaactagaagactctcttatgattctggacacttgaagatggtatatcagacaaagataatgcctgtcacgaatgatcggagaatagtaaccgcttgtgcagttggtcaggtgaggctaggtgaggtcttagaggatggccaagtacatacaaaaaggttagggagtcacagaggcgctgttcacaagctggctgtagagcctggaaaccccaacatactttacagctgtggtgacgattcttttattcaacactttgatctgcgaagcaatactgctacgaagctattcagttgctccaaattgataagaggagagcagcatcctttcatgttagatttgtatgacatggtgattgacccatggaatccaaactacttttgtctaggaggcaatgatgcatatgcacgcgtctatgacatgagaaaatgctggcaggatgcttcaggtggtttagttaaacctgtgaacacatttcgccctgctcacctgattcagacaacccattttatgatcacggggttggcgtactccaactccggtgagctacttgtgagttatagtgatgagcacatttatctgttccagaagaatatggggttgggtcattccccatcgttcctacctaaagacatggcggagcttgacaagccagaacaattcattggtcatagaaatataaacacatgtagagtgagtttctttgggccaaatgatgagtatgtcttgagtgggagttattgcggccatattttcatatggaagaagaatggaggtgaactcattcgtgttatgatgggcgattctctcggtgtacatgacattcagctgcatccacataatccggtcattgccaccggcggatcgggaaacaatctaaagctctggactcctatggcaaatgatcatgcatctccactgcctgacaacattgcacaggtgctttctcaatctctcgctgtctcgcagagtaaaagatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005739 GO:0005829 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0019538 GO:0031461 GO:0031974 GO:0031981 GO:0032991 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0043687 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0070013 GO:0071704 GO:0080008 GO:1901564 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

404

Amino Acids

45.58

Weight (kDa)

8.06

Isoelectric Point (pI)

44.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010743)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G45620 AT3G45620
fragaria_vesca	FvH4_3g33730 FvH4_3g34190
rosa_chinensis	RchiOBHm_Chr5g0061271
rosa_laevigata	RLG00000031642 RLG00000035447 RLG00000035448
rosa_multiflora	Rmu_sc0007612.1_g000043
rosa_roxburghii	Rroxscaffold_1G00019440
rosa_rugosa	Rorug04G0441700 Rorug05G0339200
rosa_samantha	Rh5AG071700 Rh5AG400400 Rh5BG068100 Rh5BG413500 Rh5CG438000 Rh5DG068300 Rh5DG427600
rosa_wichuraiana	Rw5G037730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	645
AciI	CCGC	4 cut(s)	327, 872, 978, 1095
AclWI	GGATC	1 cut(s)	1105
AcoI	YGGCCR	2 cut(s)	373, 979
AcsI	RAATTY	1 cut(s)	161
AcuI	CTGAAG	1 cut(s)	663
AfaI	GTAC	3 cut(s)	381, 764, 1050
AfiI	CCNNNNNNNGG	1 cut(s)	43
AflIII	ACRYGT	2 cut(s)	643, 920
AgsI	TTSAA	3 cut(s)	166, 271, 485
AjnI	CCWGG	1 cut(s)	436
AjuI	GAANNNNNNNTTGG	4 cut(s)	818, 850, 882, 914
AluBI	AGCT	8 cut(s)	153, 424, 462, 520, 781, 877, 1063, 1117
AluI	AGCT	8 cut(s)	153, 424, 462, 520, 781, 877, 1063, 1117
Alw21I	GWGCWC	1 cut(s)	807
Alw26I	GTCTC	2 cut(s)	35, 1201
AlwI	GGATC	1 cut(s)	1105
AoxI	GGCC	4 cut(s)	46, 373, 941, 979
ApeKI	GCWGC	2 cut(s)	553, 1063
ApoI	RAATTY	1 cut(s)	161
Asp700I	GAANNNNTTC	2 cut(s)	521, 1017
AspLEI	GCGC	1 cut(s)	413
AspS9I	GGNCC	2 cut(s)	46, 941
AsuHPI	GGTGA	8 cut(s)	188, 358, 368, 479, 598, 713, 788, 1022
BalI	TGGCCA	1 cut(s)	375
BbsI	GAAGAC	1 cut(s)	250
Bbv12I	GWGCWC	1 cut(s)	807
BbvI	GCAGC	2 cut(s)	565, 1050
BccI	CCATC	4 cut(s)	268, 365, 856, 1024
BceAI	ACGGC	1 cut(s)	68
BciT130I	CCWGG	1 cut(s)	438
BclI	TGATCA	2 cut(s)	747, 1138
BcoDI	GTCTC	2 cut(s)	35, 1201
BfaI	CTAG	3 cut(s)	240, 353, 620
BfmI	CTRYAG	1 cut(s)	429
BfoI	RGCGCY	1 cut(s)	414
BisI	GCNGC	3 cut(s)	554, 979, 1064
BlsI	GCNGC	3 cut(s)	555, 980, 1065
Bme1390I	CCNGG	1 cut(s)	438
BmgT120I	GGNCC	2 cut(s)	46, 941
BmrFI	CCNGG	1 cut(s)	438
BmrI	ACTGGG	1 cut(s)	235
BmsI	GCATC	6 cut(s)	105, 565, 622, 664, 1075, 1154
BmuI	ACTGGG	1 cut(s)	235
BpiI	GAAGAC	1 cut(s)	250
BplI	GAGNNNNNCTC	2 cut(s)	999, 1031
BpuEI	CTTGAG	1 cut(s)	982
BsaJI	CCNNGG	1 cut(s)	596
BsaWI	WCCGGW	2 cut(s)	773, 1078
BsaXI	ACNNNNNCTCC	2 cut(s)	755, 785
Bsc4I	CCNNNNNNNGG	1 cut(s)	43
Bse118I	RCCGGY	1 cut(s)	1091
Bse1I	ACTGG	1 cut(s)	230
Bse3DI	GCAATG	3 cut(s)	634, 1083, 1164
BseBI	CCWGG	1 cut(s)	438
BseDI	CCNNGG	1 cut(s)	596
BseGI	GGATG	4 cut(s)	376, 556, 679, 1066
BseLI	CCNNNNNNNGG	1 cut(s)	43
BseMI	GCAATG	3 cut(s)	634, 1083, 1164
BseNI	ACTGG	1 cut(s)	230
BseRI	GAGGAG	1 cut(s)	561
BseXI	GCAGC	2 cut(s)	565, 1050
BsgI	GTGCAG	1 cut(s)	354
Bsh1236I	CGCG	1 cut(s)	645
BshFI	GGCC	4 cut(s)	48, 375, 943, 981
BsiHKAI	GWGCWC	1 cut(s)	807
BsiSI	CCGG	3 cut(s)	774, 1079, 1092
BslI	CCNNNNNNNGG	1 cut(s)	43
BsmAI	GTCTC	2 cut(s)	35, 1201
BsmBI	CGTCTC	1 cut(s)	35
BsnI	GGCC	4 cut(s)	48, 375, 943, 981
Bsp1286I	GDGCHC	1 cut(s)	807
Bsp1407I	TGTACA	1 cut(s)	1048
Bsp143I	GATC	5 cut(s)	310, 493, 747, 1097, 1138
Bsp19I	CCATGG	1 cut(s)	596
BspACI	CCGC	4 cut(s)	327, 872, 978, 1095
BspANI	GGCC	4 cut(s)	48, 375, 943, 981
BspFNI	CGCG	1 cut(s)	645
BspPI	GGATC	1 cut(s)	1105
BsrDI	GCAATG	3 cut(s)	634, 1083, 1164
BsrFI	RCCGGY	1 cut(s)	1091
BsrGI	TGTACA	1 cut(s)	1048
BsrI	ACTGG	1 cut(s)	230
BssAI	RCCGGY	1 cut(s)	1091
BssECI	CCNNGG	1 cut(s)	596
BssMI	GATC	5 cut(s)	310, 493, 747, 1097, 1138
BssT1I	CCWWGG	1 cut(s)	596
Bst2UI	CCWGG	1 cut(s)	438
BstAUI	TGTACA	1 cut(s)	1048
BstC8I	GCNNGC	3 cut(s)	426, 643, 668
BstDEI	CTNAG	1 cut(s)	364
BstDSI	CCRYGG	1 cut(s)	596
BstEII	GGTNACC	1 cut(s)	176
BstF5I	GGATG	4 cut(s)	376, 556, 679, 1066
BstFNI	CGCG	1 cut(s)	645
BstH2I	RGCGCY	1 cut(s)	414
BstHHI	GCGC	1 cut(s)	413
BstKTI	GATC	5 cut(s)	313, 496, 750, 1100, 1141
BstMAI	GTCTC	2 cut(s)	35, 1201
BstMBI	GATC	5 cut(s)	310, 493, 747, 1097, 1138
BstMWI	GCNNNNNNNGC	1 cut(s)	883
BstNI	CCWGG	1 cut(s)	438
BstNSI	RCATGY	1 cut(s)	924
BstPI	GGTNACC	1 cut(s)	176
BstSCI	CCNGG	1 cut(s)	436
BstSFI	CTRYAG	1 cut(s)	429
BstUI	CGCG	1 cut(s)	645
BstV1I	GCAGC	2 cut(s)	565, 1050
BstV2I	GAAGAC	1 cut(s)	250
BsuRI	GGCC	4 cut(s)	48, 375, 943, 981
BtgI	CCRYGG	1 cut(s)	596
BtsCI	GGATG	4 cut(s)	376, 556, 679, 1066
BtsI	GCAGTG	1 cut(s)	1151
BtsIMutI	CAGTG	1 cut(s)	1151
Cac8I	GCNNGC	3 cut(s)	426, 643, 668
CfoI	GCGC	1 cut(s)	413
Cfr10I	RCCGGY	1 cut(s)	1091
Cfr13I	GGNCC	2 cut(s)	46, 941
CseI	GACGC	2 cut(s)	72, 634
Csp6I	GTAC	3 cut(s)	380, 763, 1049
CviAII	CATG	8 cut(s)	565, 583, 597, 655, 868, 921, 1052, 1142
CviQI	GTAC	3 cut(s)	380, 763, 1049
DdeI	CTNAG	1 cut(s)	364
DpnI	GATC	5 cut(s)	312, 495, 749, 1099, 1140
DpnII	GATC	5 cut(s)	310, 493, 747, 1097, 1138
EaeI	YGGCCR	2 cut(s)	373, 979
EciI	GGCGGA	2 cut(s)	887, 1110
Eco130I	CCWWGG	1 cut(s)	596
Eco57I	CTGAAG	1 cut(s)	663
Eco91I	GGTNACC	1 cut(s)	176
EcoO65I	GGTNACC	1 cut(s)	176
EcoRI	GAATTC	1 cut(s)	161
EcoRII	CCWGG	1 cut(s)	436
EcoT14I	CCWWGG	1 cut(s)	596
EcoT22I	ATGCAT	2 cut(s)	637, 1147
ErhI	CCWWGG	1 cut(s)	596
Esp3I	CGTCTC	1 cut(s)	35
FaeI	CATG	8 cut(s)	568, 586, 600, 658, 871, 924, 1055, 1145
FalI	AAGNNNNNCTT	2 cut(s)	235, 267
FatI	CATG	8 cut(s)	564, 582, 596, 654, 867, 920, 1051, 1141
FauNDI	CATATG	2 cut(s)	637, 992
FbaI	TGATCA	2 cut(s)	747, 1138
Fnu4HI	GCNGC	3 cut(s)	554, 979, 1064
FokI	GGATG	4 cut(s)	383, 543, 686, 1053
Fsp4HI	GCNGC	3 cut(s)	554, 979, 1064
FspBI	CTAG	3 cut(s)	240, 353, 620
GlaI	GCGC	1 cut(s)	412
GluI	GCNGC	3 cut(s)	554, 979, 1064
HaeII	RGCGCY	1 cut(s)	414
HaeIII	GGCC	4 cut(s)	48, 375, 943, 981
HapII	CCGG	3 cut(s)	774, 1079, 1092
HgaI	GACGC	2 cut(s)	72, 634
HhaI	GCGC	1 cut(s)	413
Hin1II	CATG	8 cut(s)	568, 586, 600, 658, 871, 924, 1055, 1145
Hin6I	GCGC	1 cut(s)	411
HinP1I	GCGC	1 cut(s)	411
HinfI	GANTC	8 cut(s)	246, 257, 400, 473, 601, 727, 1037, 1123
HpaII	CCGG	3 cut(s)	774, 1079, 1092
HphI	GGTGA	8 cut(s)	188, 358, 368, 479, 598, 713, 788, 1022
Hpy166II	GTNNAC	4 cut(s)	418, 703, 1013, 1049
Hpy188I	TCNGA	3 cut(s)	285, 315, 732
Hpy188III	TCNNGA	6 cut(s)	261, 304, 820, 961, 1101, 1120
Hpy8I	GTNNAC	4 cut(s)	418, 703, 1013, 1049
HpyCH4V	TGCA	8 cut(s)	4, 33, 335, 635, 641, 1066, 1145, 1169
HpyF10VI	GCNNNNNNNGC	1 cut(s)	883
HpyF3I	CTNAG	1 cut(s)	364
Hsp92II	CATG	8 cut(s)	568, 586, 600, 658, 871, 924, 1055, 1145
HspAI	GCGC	1 cut(s)	411
Ksp22I	TGATCA	2 cut(s)	747, 1138
Kzo9I	GATC	5 cut(s)	310, 493, 747, 1097, 1138
LmnI	GCTCC	3 cut(s)	158, 536, 874
Lsp1109I	GCAGC	2 cut(s)	565, 1050
LweI	GCATC	6 cut(s)	105, 565, 622, 664, 1075, 1154
MaeI	CTAG	3 cut(s)	240, 353, 620
MaeIII	GTNAC	5 cut(s)	176, 301, 322, 401, 467
MalI	GATC	5 cut(s)	312, 495, 749, 1099, 1140
MboI	GATC	5 cut(s)	310, 493, 747, 1097, 1138
MboII	GAAGA	6 cut(s)	13, 255, 283, 835, 1009, 1012
MhlI	GDGCHC	1 cut(s)	807
MlsI	TGGCCA	1 cut(s)	375
MluCI	AATT	5 cut(s)	107, 125, 161, 536, 893
MluI	ACGCGT	1 cut(s)	643
MluNI	TGGCCA	1 cut(s)	375
MlyI	GAGTC	3 cut(s)	240, 409, 1117
MmeI	TCCRAC	1 cut(s)	792
MnlI	CCTC	8 cut(s)	191, 342, 352, 361, 401, 539, 617, 1001
Mox20I	TGGCCA	1 cut(s)	375
Mph1103I	ATGCAT	2 cut(s)	637, 1147
MroXI	GAANNNNTTC	2 cut(s)	521, 1017
MscI	TGGCCA	1 cut(s)	375
MseI	TTAA	2 cut(s)	128, 693
Msp20I	TGGCCA	1 cut(s)	375
MspA1I	CMGCKG	2 cut(s)	462, 1063
MspI	CCGG	3 cut(s)	774, 1079, 1092
MspR9I	CCNGG	1 cut(s)	438
MvaI	CCWGG	1 cut(s)	438
MvnI	CGCG	1 cut(s)	645
MwoI	GCNNNNNNNGC	1 cut(s)	883
NcoI	CCATGG	1 cut(s)	596
NdeI	CATATG	2 cut(s)	637, 992
NdeII	GATC	5 cut(s)	310, 493, 747, 1097, 1138
NlaIII	CATG	8 cut(s)	568, 586, 600, 658, 871, 924, 1055, 1145
NmuCI	GTSAC	4 cut(s)	176, 301, 401, 467
NsiI	ATGCAT	2 cut(s)	637, 1147
NspI	RCATGY	1 cut(s)	924
PciI	ACATGT	1 cut(s)	920
PcsI	WCGNNNNNNNCGW	2 cut(s)	70, 758
PdmI	GAANNNNTTC	2 cut(s)	521, 1017
PfeI	GAWTC	5 cut(s)	257, 473, 601, 727, 1037
PkrI	GCNGC	3 cut(s)	555, 980, 1065
PleI	GAGTC	3 cut(s)	240, 408, 1117
PpsI	GAGTC	3 cut(s)	240, 408, 1117
PscI	ACATGT	1 cut(s)	920
Psp6I	CCWGG	1 cut(s)	436
PspEI	GGTNACC	1 cut(s)	176
PspGI	CCWGG	1 cut(s)	436
PspPI	GGNCC	2 cut(s)	46, 941
PvuII	CAGCTG	2 cut(s)	462, 1063
RsaI	GTAC	3 cut(s)	381, 764, 1050
RsaNI	GTAC	3 cut(s)	380, 763, 1049
SaqAI	TTAA	2 cut(s)	128, 693
SatI	GCNGC	3 cut(s)	554, 979, 1064
Sau3AI	GATC	5 cut(s)	310, 493, 747, 1097, 1138
Sau96I	GGNCC	2 cut(s)	46, 941
SchI	GAGTC	3 cut(s)	240, 409, 1117
ScrFI	CCNGG	1 cut(s)	438
SduI	GDGCHC	1 cut(s)	807
SfaNI	GCATC	6 cut(s)	105, 565, 622, 664, 1075, 1154
SfcI	CTRYAG	1 cut(s)	429
SgrAI	CRCCGGYG	1 cut(s)	1091
SmlI	CTYRAG	1 cut(s)	961
SmoI	CTYRAG	1 cut(s)	961
Sse9I	AATT	5 cut(s)	107, 125, 161, 536, 893
SsiI	CCGC	4 cut(s)	327, 872, 978, 1095
SspMI	CTAG	3 cut(s)	240, 353, 620
StyD4I	CCNGG	1 cut(s)	436
StyI	CCWWGG	1 cut(s)	596
TaqI	TCGA	1 cut(s)	24
TasI	AATT	5 cut(s)	107, 125, 161, 536, 893
TatI	WGTACW	2 cut(s)	379, 1048
TauI	GCSGC	1 cut(s)	981
TfiI	GAWTC	5 cut(s)	257, 473, 601, 727, 1037
Tru1I	TTAA	2 cut(s)	128, 693
Tru9I	TTAA	2 cut(s)	128, 693
TscAI	CASTG	1 cut(s)	1158
TseFI	GTSAC	4 cut(s)	176, 301, 401, 467
TseI	GCWGC	2 cut(s)	553, 1063
Tsp45I	GTSAC	4 cut(s)	176, 301, 401, 467
TspDTI	ATGAA	3 cut(s)	553, 886, 979
TspRI	CASTG	1 cut(s)	1158
XapI	RAATTY	1 cut(s)	161
XceI	RCATGY	1 cut(s)	924
XmnI	GAANNNNTTC	2 cut(s)	521, 1017
XspI	CTAG	3 cut(s)	240, 353, 620
Zsp2I	ATGCAT	2 cut(s)	637, 1147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.