Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007698.1

Orthogroup ID

OG0005637

Physical Location & Seq

Genomic Coordinates Forward (+)

49301 .. 51615

Gene Structure 2315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007698.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1125 bp

atgtcgtcttcgtgtgcggtttcgacttcagtgagaacacagttgtttaattcagtacctgagaacaggttcattgcccctacaagaccatttcagtaccacggaagtaaatgtgtgatgagcaggaggggttttgcttttagaggagttgcagctgcagggctttcagtagtgggttcttcttctttggctactgagcctgctcaaggtattgaaagactgcctttcaaaccagaggggtacaatttttggacttggagaggtcataaaattcattatgtcgtgcaaggagaagggcctgctgttcttcttattcatggttttggtgcttcttcatttcactggaggtataacataccagagttggctaaaaaatacaaggtttatgctatagacttgctgggcttcggttggagtgaaaaagcactggttgaatatgatgccatgatttggaaagatcaagtagtggacttcttgaaggagatagtgaaagaaccaacagttttgggttctgtgttgggaggttttactgctttggttgcagcagttggattgcctgagcaagtagttggagttgcactattgaattcagcaggacagtttggaaatgcaaatagtgaacctgagaagtctgacgaggaaacagtcctacagaagttcatcataaagccactgaaggaagttttccagcgagtagtacttggatttttattctggcaagcaaagcagcccgctcgcattgaatccgttttaaagagtgtgtacaaaaatacctccaatgtggatgactatctggtagaatccataacaatgccagcagctgaccccaatgccagagaagtctactacagaatgatgacgcggttcatgtcaaaccagaccaagtatactcttgacagtatcctaagcaagatgtcttgcccattgttgttgctctggggtgacttggacccatgggtaggtcctgccaaggctaacagaatcaaagagttctatccaaattcaactttggtaaatttgcaggctggccactgtccacacgatgaagttccagagcttgtaaacaaggctttattagaatggctctcaacttcgacagctgaggcctctctccaaacagtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abhydrolase_1 Abhydrolase_6

Protein Analysis

374

Amino Acids

41.61

Weight (kDa)

7.66

Isoelectric Point (pI)

42.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005637)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G36530 AT4G36530
fragaria_vesca	FvH4_1g13000 FvH4_1g13000 FvH4_1g13000
malus_domestica	MD15G1258200.v1.1
prunus_persica	Prupe.7G157100_v2.0.a1
pyrus_communis	pycom02g11440 pycom15g22600
rosa_chinensis	RchiOBHm_Chr2g0101081 RchiOBHm_Chr4g0423241 RchiOBHm_Chr6g0260581
rosa_laevigata	RLG00000017050
rosa_multiflora	Rmu_sc0007698.1_g000013
rosa_roxburghii	Rroxscaffold_2G00095650 Rroxscaffold_2G00141570 Rroxscaffold_5G00364280
rosa_rugosa	Rorug02G0097000
rosa_samantha	Rh2AG143000 Rh2BG148100 Rh2CG149600 Rh2DG148600 Rh5DG463100 Rh6CG159800
rosa_wichuraiana	Rw2G003750 Rw2G011270 Rw3G026160 Rw7G016520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	450
AccBSI	CCGCTC	1 cut(s)	734
AccI	GTMKAC	2 cut(s)	843, 887
AccII	CGCG	1 cut(s)	862
AciI	CCGC	3 cut(s)	17, 732, 862
AcoI	YGGCCR	1 cut(s)	1027
AcsI	RAATTY	4 cut(s)	270, 586, 1000, 1015
AcuI	CTGAAG	2 cut(s)	12, 695
AfaI	GTAC	5 cut(s)	57, 98, 242, 699, 764
AfiI	CCNNNNNNNGG	3 cut(s)	206, 450, 959
AgsI	TTSAA	7 cut(s)	215, 229, 434, 478, 586, 743, 1005
AluBI	AGCT	4 cut(s)	155, 821, 1057, 1100
AluI	AGCT	4 cut(s)	155, 821, 1057, 1100
AlwNI	CAGNNNCTG	2 cut(s)	59, 821
AoxI	GGCC	3 cut(s)	296, 1027, 1104
ApeKI	GCWGC	5 cut(s)	152, 155, 542, 727, 818
ApoI	RAATTY	4 cut(s)	270, 586, 1000, 1015
Asp700I	GAANNNNTTC	1 cut(s)	68
AspS9I	GGNCC	3 cut(s)	296, 949, 962
AsuHPI	GGTGA	1 cut(s)	953
AvaII	GGWCC	2 cut(s)	949, 962
BalI	TGGCCA	1 cut(s)	1029
BbvCI	CCTCAGC	1 cut(s)	1101
BbvI	GCAGC	5 cut(s)	142, 164, 554, 739, 830
BcgI	CGANNNNNNTGC	2 cut(s)	716, 750
BciVI	GTATCC	1 cut(s)	911
BfmI	CTRYAG	4 cut(s)	156, 390, 650, 847
BfuI	GTATCC	1 cut(s)	911
BisI	GCNGC	5 cut(s)	153, 156, 543, 728, 819
BlsI	GCNGC	5 cut(s)	154, 157, 544, 729, 820
BmcAI	AGTACT	1 cut(s)	699
Bme18I	GGWCC	2 cut(s)	949, 962
BmgT120I	GGNCC	3 cut(s)	296, 949, 962
BmiI	GGNNCC	1 cut(s)	951
BmsI	GCATC	1 cut(s)	430
BpmI	CTGGAG	1 cut(s)	364
Bpu10I	CCTNAGC	3 cut(s)	558, 905, 1101
BpuEI	CTTGAG	1 cut(s)	189
BsaBI	GATNNNNATC	1 cut(s)	789
BsaJI	CCNNGG	3 cut(s)	100, 953, 969
Bsc4I	CCNNNNNNNGG	3 cut(s)	206, 450, 959
Bse1I	ACTGG	2 cut(s)	347, 432
Bse3DI	GCAATG	1 cut(s)	72
Bse8I	GATNNNNATC	1 cut(s)	789
BseDI	CCNNGG	3 cut(s)	100, 953, 969
BseGI	GGATG	1 cut(s)	790
BseJI	GATNNNNATC	1 cut(s)	789
BseLI	CCNNNNNNNGG	3 cut(s)	206, 450, 959
BseMI	GCAATG	1 cut(s)	72
BseMII	CTCAG	5 cut(s)	51, 186, 549, 615, 1092
BseNI	ACTGG	2 cut(s)	347, 432
BseRI	GAGGAG	1 cut(s)	159
BseXI	GCAGC	5 cut(s)	142, 164, 554, 739, 830
BseYI	CCCAGC	1 cut(s)	400
Bsh1236I	CGCG	1 cut(s)	862
BshFI	GGCC	3 cut(s)	298, 1029, 1106
BslI	CCNNNNNNNGG	3 cut(s)	206, 450, 959
BsnI	GGCC	3 cut(s)	298, 1029, 1106
Bsp1407I	TGTACA	1 cut(s)	762
Bsp143I	GATC	1 cut(s)	457
Bsp19I	CCATGG	1 cut(s)	953
BspACI	CCGC	3 cut(s)	17, 732, 862
BspANI	GGCC	3 cut(s)	298, 1029, 1106
BspCNI	CTCAG	5 cut(s)	52, 187, 550, 616, 1093
BspFNI	CGCG	1 cut(s)	862
BspLI	GGNNCC	1 cut(s)	951
BspMAI	CTGCAG	1 cut(s)	160
BsrBI	CCGCTC	1 cut(s)	734
BsrDI	GCAATG	1 cut(s)	72
BsrGI	TGTACA	1 cut(s)	762
BsrI	ACTGG	2 cut(s)	347, 432
BssECI	CCNNGG	3 cut(s)	100, 953, 969
BssMI	GATC	1 cut(s)	457
BssNAI	GTATAC	1 cut(s)	888
BssT1I	CCWWGG	2 cut(s)	953, 969
Bst1107I	GTATAC	1 cut(s)	888
Bst4CI	ACNGT	7 cut(s)	42, 502, 600, 646, 899, 1034, 1120
BstAUI	TGTACA	1 cut(s)	762
BstC8I	GCNNGC	8 cut(s)	201, 300, 720, 732, 736, 816, 1023, 1027
BstDEI	CTNAG	6 cut(s)	60, 195, 558, 624, 905, 1101
BstDSI	CCRYGG	2 cut(s)	100, 953
BstENI	CCTNNNNNAGG	1 cut(s)	204
BstF5I	GGATG	1 cut(s)	790
BstFNI	CGCG	1 cut(s)	862
BstKTI	GATC	1 cut(s)	460
BstMBI	GATC	1 cut(s)	457
BstMWI	GCNNNNNNNGC	2 cut(s)	539, 724
BstSFI	CTRYAG	4 cut(s)	156, 390, 650, 847
BstUI	CGCG	1 cut(s)	862
BstV1I	GCAGC	5 cut(s)	142, 164, 554, 739, 830
BstZ17I	GTATAC	1 cut(s)	888
BsuI	GTATCC	1 cut(s)	911
BsuRI	GGCC	3 cut(s)	298, 1029, 1106
BtgI	CCRYGG	2 cut(s)	100, 953
BtsCI	GGATG	1 cut(s)	790
BtsIMutI	CAGTG	5 cut(s)	36, 340, 425, 671, 1030
Cac8I	GCNNGC	8 cut(s)	201, 300, 720, 732, 736, 816, 1023, 1027
CaiI	CAGNNNCTG	2 cut(s)	59, 821
Cfr13I	GGNCC	3 cut(s)	296, 949, 962
CseI	GACGC	1 cut(s)	868
Csp6I	GTAC	5 cut(s)	56, 97, 241, 698, 763
CviAII	CATG	4 cut(s)	317, 445, 868, 954
CviQI	GTAC	5 cut(s)	56, 97, 241, 698, 763
DdeI	CTNAG	6 cut(s)	60, 195, 558, 624, 905, 1101
DpnI	GATC	1 cut(s)	459
DpnII	GATC	1 cut(s)	457
DraI	TTTAAA	1 cut(s)	753
EaeI	YGGCCR	1 cut(s)	1027
Eco130I	CCWWGG	2 cut(s)	953, 969
Eco147I	AGGCCT	1 cut(s)	1106
Eco47I	GGWCC	2 cut(s)	949, 962
Eco57I	CTGAAG	2 cut(s)	12, 695
EcoNI	CCTNNNNNAGG	1 cut(s)	204
EcoO109I	RGGNCCY	2 cut(s)	296, 962
EcoRI	GAATTC	1 cut(s)	586
EcoT14I	CCWWGG	2 cut(s)	953, 969
ErhI	CCWWGG	2 cut(s)	953, 969
FaeI	CATG	4 cut(s)	320, 448, 871, 957
FalI	AAGNNNNNCTT	2 cut(s)	208, 240
FatI	CATG	4 cut(s)	316, 444, 867, 953
FauI	CCCGC	1 cut(s)	739
FblI	GTMKAC	2 cut(s)	843, 887
Fnu4HI	GCNGC	5 cut(s)	153, 156, 543, 728, 819
FokI	GGATG	1 cut(s)	797
Fsp4HI	GCNGC	5 cut(s)	153, 156, 543, 728, 819
GluI	GCNGC	5 cut(s)	153, 156, 543, 728, 819
GsaI	CCCAGC	1 cut(s)	404
GsuI	CTGGAG	1 cut(s)	364
HaeIII	GGCC	3 cut(s)	298, 1029, 1106
HgaI	GACGC	1 cut(s)	868
Hin1II	CATG	4 cut(s)	320, 448, 871, 957
HinfI	GANTC	3 cut(s)	743, 800, 981
HphI	GGTGA	1 cut(s)	953
Hpy166II	GTNNAC	7 cut(s)	469, 620, 763, 844, 888, 1037, 1063
Hpy188I	TCNGA	1 cut(s)	634
Hpy188III	TCNNGA	3 cut(s)	475, 893, 1052
Hpy8I	GTNNAC	7 cut(s)	469, 620, 763, 844, 888, 1037, 1063
HpyAV	CCTTC	3 cut(s)	287, 472, 670
HpyCH4III	ACNGT	7 cut(s)	42, 502, 600, 646, 899, 1034, 1120
HpyCH4V	TGCA	7 cut(s)	152, 158, 286, 542, 578, 611, 1021
HpyF10VI	GCNNNNNNNGC	2 cut(s)	539, 724
HpyF3I	CTNAG	6 cut(s)	60, 195, 558, 624, 905, 1101
Hsp92II	CATG	4 cut(s)	320, 448, 871, 957
Kzo9I	GATC	1 cut(s)	457
Lsp1109I	GCAGC	5 cut(s)	142, 164, 554, 739, 830
LweI	GCATC	1 cut(s)	430
MaeIII	GTNAC	1 cut(s)	941
MalI	GATC	1 cut(s)	459
MbiI	CCGCTC	1 cut(s)	734
MboI	GATC	1 cut(s)	457
MboII	GAAGA	4 cut(s)	171, 174, 299, 324
MlsI	TGGCCA	1 cut(s)	1029
MluCI	AATT	6 cut(s)	49, 244, 270, 586, 1000, 1015
MluNI	TGGCCA	1 cut(s)	1029
MmeI	TCCRAC	3 cut(s)	392, 529, 550
Mox20I	TGGCCA	1 cut(s)	1029
MroXI	GAANNNNTTC	1 cut(s)	68
MscI	TGGCCA	1 cut(s)	1029
MseI	TTAA	2 cut(s)	48, 752
MslI	CAYNNNNRTG	1 cut(s)	809
Msp20I	TGGCCA	1 cut(s)	1029
MspA1I	CMGCKG	3 cut(s)	155, 821, 1100
MvnI	CGCG	1 cut(s)	862
MwoI	GCNNNNNNNGC	2 cut(s)	539, 724
NcoI	CCATGG	1 cut(s)	953
NdeII	GATC	1 cut(s)	457
NlaIII	CATG	4 cut(s)	320, 448, 871, 957
NlaIV	GGNNCC	1 cut(s)	951
NmuCI	GTSAC	1 cut(s)	941
PceI	AGGCCT	1 cut(s)	1106
PdmI	GAANNNNTTC	1 cut(s)	68
PfeI	GAWTC	3 cut(s)	743, 800, 981
PflMI	CCANNNNNTGG	1 cut(s)	450
PkrI	GCNGC	5 cut(s)	154, 157, 544, 729, 820
PpuMI	RGGWCCY	1 cut(s)	962
Psp5II	RGGWCCY	1 cut(s)	962
PspFI	CCCAGC	1 cut(s)	400
PspN4I	GGNNCC	1 cut(s)	951
PspPI	GGNCC	3 cut(s)	296, 949, 962
PspPPI	RGGWCCY	1 cut(s)	962
PstI	CTGCAG	1 cut(s)	160
PstNI	CAGNNNCTG	2 cut(s)	59, 821
PvuII	CAGCTG	3 cut(s)	155, 821, 1100
RsaI	GTAC	5 cut(s)	57, 98, 242, 699, 764
RsaNI	GTAC	5 cut(s)	56, 97, 241, 698, 763
RseI	CAYNNNNRTG	1 cut(s)	809
SaqAI	TTAA	2 cut(s)	48, 752
SatI	GCNGC	5 cut(s)	153, 156, 543, 728, 819
Sau3AI	GATC	1 cut(s)	457
Sau96I	GGNCC	3 cut(s)	296, 949, 962
ScaI	AGTACT	1 cut(s)	699
SfaNI	GCATC	1 cut(s)	430
SfcI	CTRYAG	4 cut(s)	156, 390, 650, 847
SinI	GGWCC	2 cut(s)	949, 962
SmiMI	CAYNNNNRTG	1 cut(s)	809
SmlI	CTYRAG	1 cut(s)	204
SmoI	CTYRAG	1 cut(s)	204
Sse9I	AATT	6 cut(s)	49, 244, 270, 586, 1000, 1015
SseBI	AGGCCT	1 cut(s)	1106
SsiI	CCGC	3 cut(s)	17, 732, 862
StuI	AGGCCT	1 cut(s)	1106
StyI	CCWWGG	2 cut(s)	953, 969
TaaI	ACNGT	7 cut(s)	42, 502, 600, 646, 899, 1034, 1120
TaqI	TCGA	2 cut(s)	23, 1094
TasI	AATT	6 cut(s)	49, 244, 270, 586, 1000, 1015
TatI	WGTACW	2 cut(s)	697, 762
TfiI	GAWTC	3 cut(s)	743, 800, 981
Tru1I	TTAA	2 cut(s)	48, 752
Tru9I	TTAA	2 cut(s)	48, 752
TscAI	CASTG	5 cut(s)	36, 347, 432, 678, 1037
TseFI	GTSAC	1 cut(s)	941
TseI	GCWGC	5 cut(s)	152, 155, 542, 727, 818
Tsp45I	GTSAC	1 cut(s)	941
TspDTI	ATGAA	7 cut(s)	61, 263, 305, 324, 649, 856, 1059
TspGWI	ACGGA	2 cut(s)	117, 736
TspRI	CASTG	5 cut(s)	36, 347, 432, 678, 1037
Van91I	CCANNNNNTGG	1 cut(s)	450
VpaK11BI	GGWCC	2 cut(s)	949, 962
XagI	CCTNNNNNAGG	1 cut(s)	204
XapI	RAATTY	4 cut(s)	270, 586, 1000, 1015
XmiI	GTMKAC	2 cut(s)	843, 887
XmnI	GAANNNNTTC	1 cut(s)	68
ZrmI	AGTACT	1 cut(s)	699

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.