Rroxscaffold_5G00364280

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
45520705 .. 45522337
1633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00364280.1

Sequence Viewer

Length: 303 bp
ATGCCGAGCAACGATGACGGGGAAGGCGAAGCCGAAGAAGCATGTGGCGATGGAGATCCAGTGAAGATCGACGCGTCTACAACAAATTGCCGAAGCGGGAAGGCGAAATCGCCGACCGGACCGAGTAGGAAAAAGGCGGACACGCCAAACTTGCCGGGCTTCGGTTGGAGTGAAAAAGCACTGGTTGAATATGATGCCATGATTTGGAAAGATCAAGTAGTGGACTTCTTGAAGGAGATAGTGAAAGAACCAACAGCTTTGGGTTCTGTGTTGGGTTTTTGCGGGGGACGATTACAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

10.63

Weight (kDa)

4.6

Isoelectric Point (pI)

42.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 204
AccI GTMKAC 1 cut(s) 77
AccII CGCG 1 cut(s) 74
AciI CCGC 3 cut(s) 96, 137, 282
AclWI GGATC 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 161, 204
AflIII ACRYGT 1 cut(s) 72
AgsI TTSAA 2 cut(s) 188, 232
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
AlwI GGATC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 119
AsuC2I CCSGG 1 cut(s) 156
AvaII GGWCC 1 cut(s) 119
BccI CCATC 1 cut(s) 44
BcnI CCSGG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 156
BmsI GCATC 1 cut(s) 184
BpuMI CCSGG 1 cut(s) 156
BsaBI GATNNNNATC 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
Bsc4I CCNNNNNNNGG 2 cut(s) 161, 204
Bse1I ACTGG 2 cut(s) 59, 186
Bse8I GATNNNNATC 1 cut(s) 54
BseJI GATNNNNATC 1 cut(s) 54
BseLI CCNNNNNNNGG 2 cut(s) 161, 204
BseNI ACTGG 2 cut(s) 59, 186
Bsh1236I CGCG 1 cut(s) 74
Bsh1285I CGRYCG 1 cut(s) 117
BsiEI CGRYCG 1 cut(s) 117
BsiSI CCGG 2 cut(s) 117, 155
BslI CCNNNNNNNGG 2 cut(s) 161, 204
Bsp143I GATC 3 cut(s) 55, 66, 211
BspACI CCGC 3 cut(s) 96, 137, 282
BspFNI CGCG 1 cut(s) 74
BspPI GGATC 1 cut(s) 50
BsrI ACTGG 2 cut(s) 59, 186
BssMI GATC 3 cut(s) 55, 66, 211
BstFNI CGCG 1 cut(s) 74
BstKTI GATC 3 cut(s) 58, 69, 214
BstMBI GATC 3 cut(s) 55, 66, 211
BstMCI CGRYCG 1 cut(s) 117
BstMWI GCNNNNNNNGC 2 cut(s) 38, 151
BstNSI RCATGY 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 154
BstUI CGCG 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
BtgZI GCGATG 1 cut(s) 63
BtsIMutI CAGTG 2 cut(s) 66, 179
Cfr13I GGNCC 1 cut(s) 119
CpoI CGGWCCG 1 cut(s) 119
CseI GACGC 2 cut(s) 63, 80
CspI CGGWCCG 1 cut(s) 119
CviAII CATG 2 cut(s) 42, 199
CviJI RGCY 3 cut(s) 32, 159, 257
CviKI_1 RGCY 3 cut(s) 32, 159, 257
DpnI GATC 3 cut(s) 57, 68, 213
DpnII GATC 3 cut(s) 55, 66, 211
EciI GGCGGA 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 119
FaeI CATG 2 cut(s) 45, 202
FaiI YATR 3 cut(s) 43, 192, 200
FatI CATG 2 cut(s) 41, 198
FauI CCCGC 2 cut(s) 89, 275
FblI GTMKAC 1 cut(s) 77
HapII CCGG 2 cut(s) 117, 155
HgaI GACGC 2 cut(s) 63, 80
Hin1II CATG 2 cut(s) 45, 202
HpaII CCGG 2 cut(s) 117, 155
Hpy166II GTNNAC 2 cut(s) 78, 223
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 2 cut(s) 78, 223
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 17, 94, 226
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 151
Hsp92II CATG 2 cut(s) 45, 202
Kzo9I GATC 3 cut(s) 55, 66, 211
LpnPI CCDG 4 cut(s) 72, 130, 167, 168
LweI GCATC 1 cut(s) 184
MalI GATC 3 cut(s) 57, 68, 213
MboI GATC 3 cut(s) 55, 66, 211
MboII GAAGA 2 cut(s) 47, 76
MflI RGATCY 1 cut(s) 55
MluCI AATT 1 cut(s) 85
MluI ACGCGT 1 cut(s) 72
MmeI TCCRAC 1 cut(s) 146
MseI TTAA 1 cut(s) 301
MspI CCGG 2 cut(s) 117, 155
MspR9I CCNGG 1 cut(s) 156
MvnI CGCG 1 cut(s) 74
MwoI GCNNNNNNNGC 2 cut(s) 38, 151
NciI CCSGG 1 cut(s) 156
NdeII GATC 3 cut(s) 55, 66, 211
NlaIII CATG 2 cut(s) 45, 202
NmeAIII GCCGAG 1 cut(s) 30
NspI RCATGY 1 cut(s) 45
PcsI WCGNNNNNNNCGW 1 cut(s) 24
PflMI CCANNNNNTGG 1 cut(s) 204
PspPI GGNCC 1 cut(s) 119
PsuI RGATCY 1 cut(s) 55
Rsr2I CGGWCCG 1 cut(s) 119
RsrII CGGWCCG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 301
Sau3AI GATC 3 cut(s) 55, 66, 211
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 156
SetI ASST 1 cut(s) 259
SfaNI GCATC 1 cut(s) 184
SinI GGWCC 1 cut(s) 119
Sse9I AATT 1 cut(s) 85
SsiI CCGC 3 cut(s) 96, 137, 282
StyD4I CCNGG 1 cut(s) 154
TaqI TCGA 1 cut(s) 69
TaqII GACCGA 1 cut(s) 136
TasI AATT 1 cut(s) 85
Tru1I TTAA 1 cut(s) 301
Tru9I TTAA 1 cut(s) 301
TscAI CASTG 2 cut(s) 66, 186
TspRI CASTG 2 cut(s) 66, 186
Van91I CCANNNNNTGG 1 cut(s) 204
VpaK11BI GGWCC 1 cut(s) 119
XceI RCATGY 1 cut(s) 45
XmiI GTMKAC 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.