Rmu_sc0007957.1_g000001

Thioredoxin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007957.1
Physical Location & Seq
Reverse (-)
3933 .. 5464
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007957.1_g000001.1.cds

Sequence Viewer

Length: 648 bp
ctgttggttttggttttaaatgggtatgcacagaacttgccccctgccaagtacgatgggttcttgtacgagcatcgcctgattgacccggattcgattctcatcgaagctttctttgacccggtctgcccggacagtagagattcctggccacccctcaaacaggccctagcctactacggccctcacgtcagtcttgctgtgcacctattaccgttgccttaccatgacaacgcttttgttgcttctcgtgctatacacattgtaaataagctgaaacctactgctacgttttccgtgttggagtggttcttcaagaatcaggagaggtattacaatgctcaaacgcgcaacatttctagggcttccattgtggatgacttagtgaagcaactaacagcagtacttgggaactcttatcatagttccctggaatcaggctttaatgaccggaaaactgatctcacaacaagggtttcctttaagtatagtacttcaagaggggtgtatggaacgcctactttctatgtaaatggatttgtattgcctgattctggtgatgctctagattttaacgggtggaaaaaagtgattgacccattagttacggcaccaaagaaacaggaaaatttgcatttcttcttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

215

Amino Acids

24.37

Weight (kDa)

7.22

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 646
AccB1I GGYRCC 1 cut(s) 610
AccII CGCG 1 cut(s) 349
AcoI YGGCCR 1 cut(s) 149
AcsI RAATTY 1 cut(s) 628
AfaI GTAC 4 cut(s) 53, 68, 405, 493
AfiI CCNNNNNNNGG 2 cut(s) 163, 554
AgsI TTSAA 2 cut(s) 316, 498
AjiI CACGTC 1 cut(s) 190
AjnI CCWGG 2 cut(s) 146, 429
AluBI AGCT 2 cut(s) 110, 274
AluI AGCT 2 cut(s) 110, 274
Alw21I GWGCWC 1 cut(s) 207
Alw44I GTGCAC 1 cut(s) 203
AoxI GGCC 3 cut(s) 149, 165, 181
ApaLI GTGCAC 1 cut(s) 203
ApoI RAATTY 1 cut(s) 628
ArsI GACNNNNNNTTYG 2 cut(s) 221, 253
AspLEI GCGC 1 cut(s) 351
AspS9I GGNCC 2 cut(s) 166, 182
AsuC2I CCSGG 3 cut(s) 89, 122, 131
AsuHPI GGTGA 1 cut(s) 569
BaeGI GKGCMC 1 cut(s) 207
BalI TGGCCA 1 cut(s) 151
BanI GGYRCC 1 cut(s) 610
BauI CACGAG 1 cut(s) 249
Bbv12I GWGCWC 1 cut(s) 207
BccI CCATC 1 cut(s) 50
BceAI ACGGC 2 cut(s) 196, 624
BciT130I CCWGG 2 cut(s) 148, 431
BcnI CCSGG 3 cut(s) 89, 122, 131
BfaI CTAG 3 cut(s) 170, 360, 566
BmcAI AGTACT 2 cut(s) 405, 493
Bme1390I CCNGG 5 cut(s) 89, 122, 131, 148, 431
BmgBI CACGTC 1 cut(s) 190
BmgT120I GGNCC 2 cut(s) 166, 182
BmiI GGNNCC 1 cut(s) 612
BmrFI CCNGG 5 cut(s) 89, 122, 131, 148, 431
BmsI GCATC 2 cut(s) 82, 550
BpuMI CCSGG 3 cut(s) 89, 122, 131
BsaBI GATNNNNATC 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 429
BsaWI WCCGGW 1 cut(s) 450
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 554
Bse8I GATNNNNATC 1 cut(s) 101
BseBI CCWGG 2 cut(s) 148, 431
BseDI CCNNGG 1 cut(s) 429
BseGI GGATG 1 cut(s) 382
BseJI GATNNNNATC 1 cut(s) 101
BseLI CCNNNNNNNGG 2 cut(s) 163, 554
BseSI GKGCMC 1 cut(s) 207
Bsh1236I CGCG 1 cut(s) 349
BshFI GGCC 3 cut(s) 151, 167, 183
BshNI GGYRCC 1 cut(s) 610
BsiHKAI GWGCWC 1 cut(s) 207
BsiSI CCGG 4 cut(s) 89, 122, 131, 451
BslI CCNNNNNNNGG 2 cut(s) 163, 554
BsnI GGCC 3 cut(s) 151, 167, 183
Bsp1286I GDGCHC 1 cut(s) 207
Bsp143I GATC 1 cut(s) 460
BspANI GGCC 3 cut(s) 151, 167, 183
BspFNI CGCG 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 612
BspT107I GGYRCC 1 cut(s) 610
BssECI CCNNGG 1 cut(s) 429
BssMI GATC 1 cut(s) 460
BssSI CACGAG 1 cut(s) 249
Bst2BI CACGAG 1 cut(s) 249
Bst2UI CCWGG 2 cut(s) 148, 431
Bst4CI ACNGT 2 cut(s) 137, 216
BstDEI CTNAG 1 cut(s) 382
BstENI CCTNNNNNAGG 1 cut(s) 161
BstF5I GGATG 1 cut(s) 382
BstFNI CGCG 1 cut(s) 349
BstHHI GCGC 1 cut(s) 351
BstKTI GATC 1 cut(s) 463
BstMBI GATC 1 cut(s) 460
BstMWI GCNNNNNNNGC 2 cut(s) 242, 251
BstNI CCWGG 2 cut(s) 148, 431
BstSCI CCNGG 5 cut(s) 87, 120, 129, 146, 429
BstSLI GKGCMC 1 cut(s) 207
BstUI CGCG 1 cut(s) 349
BsuRI GGCC 3 cut(s) 151, 167, 183
BtgZI GCGATG 1 cut(s) 59
BtrI CACGTC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 382
CfoI GCGC 1 cut(s) 351
Cfr13I GGNCC 2 cut(s) 166, 182
Csp6I GTAC 4 cut(s) 52, 67, 404, 492
CviAII CATG 1 cut(s) 227
CviJI RGCY 8 cut(s) 110, 151, 167, 173, 183, 274, 365, 441
CviKI_1 RGCY 8 cut(s) 110, 151, 167, 173, 183, 274, 365, 441
CviQI GTAC 4 cut(s) 52, 67, 404, 492
DdeI CTNAG 1 cut(s) 382
DpnI GATC 1 cut(s) 462
DpnII GATC 1 cut(s) 460
DraI TTTAAA 1 cut(s) 18
EaeI YGGCCR 1 cut(s) 149
EcoNI CCTNNNNNAGG 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 166
EcoRII CCWGG 2 cut(s) 146, 429
FaeI CATG 1 cut(s) 230
FaiI YATR 8 cut(s) 27, 228, 257, 423, 489, 510, 528, 646
FatI CATG 1 cut(s) 226
FokI GGATG 1 cut(s) 389
FspBI CTAG 3 cut(s) 170, 360, 566
GlaI GCGC 1 cut(s) 350
HaeIII GGCC 3 cut(s) 151, 167, 183
HapII CCGG 4 cut(s) 89, 122, 131, 451
HhaI GCGC 1 cut(s) 351
Hin1II CATG 1 cut(s) 230
Hin6I GCGC 1 cut(s) 349
HinP1I GCGC 1 cut(s) 349
HindIII AAGCTT 1 cut(s) 108
HinfI GANTC 6 cut(s) 92, 97, 143, 319, 434, 551
HpaII CCGG 4 cut(s) 89, 122, 131, 451
HphI GGTGA 1 cut(s) 569
Hpy166II GTNNAC 1 cut(s) 205
Hpy188III TCNNGA 4 cut(s) 316, 323, 498, 566
Hpy8I GTNNAC 1 cut(s) 205
HpyCH4III ACNGT 2 cut(s) 137, 216
HpyCH4IV ACGT 2 cut(s) 189, 290
HpyCH4V TGCA 3 cut(s) 29, 205, 634
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 251
HpyF3I CTNAG 1 cut(s) 382
HpySE526I ACGT 2 cut(s) 189, 290
Hsp92II CATG 1 cut(s) 230
HspAI GCGC 1 cut(s) 349
Kzo9I GATC 1 cut(s) 460
LweI GCATC 2 cut(s) 82, 550
MaeI CTAG 3 cut(s) 170, 360, 566
MaeII ACGT 2 cut(s) 189, 290
MaeIII GTNAC 1 cut(s) 604
MalI GATC 1 cut(s) 462
MboI GATC 1 cut(s) 460
MboII GAAGA 2 cut(s) 304, 631
MhlI GDGCHC 1 cut(s) 207
MlsI TGGCCA 1 cut(s) 151
MluCI AATT 1 cut(s) 628
MluNI TGGCCA 1 cut(s) 151
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 4 cut(s) 167, 195, 321, 494
Mox20I TGGCCA 1 cut(s) 151
MscI TGGCCA 1 cut(s) 151
MseI TTAA 4 cut(s) 17, 444, 483, 573
Msp20I TGGCCA 1 cut(s) 151
MspI CCGG 4 cut(s) 89, 122, 131, 451
MspR9I CCNGG 5 cut(s) 89, 122, 131, 148, 431
MvaI CCWGG 2 cut(s) 148, 431
MvnI CGCG 1 cut(s) 349
MwoI GCNNNNNNNGC 2 cut(s) 242, 251
NciI CCSGG 3 cut(s) 89, 122, 131
NdeII GATC 1 cut(s) 460
NlaIII CATG 1 cut(s) 230
NlaIV GGNNCC 1 cut(s) 612
PcsI WCGNNNNNNNCGW 1 cut(s) 186
PfeI GAWTC 6 cut(s) 92, 97, 143, 319, 434, 551
PflFI GACNNNGTC 1 cut(s) 122
PsiI TTATAA 1 cut(s) 646
Psp6I CCWGG 2 cut(s) 146, 429
PspGI CCWGG 2 cut(s) 146, 429
PspN4I GGNNCC 1 cut(s) 612
PspPI GGNCC 2 cut(s) 166, 182
PsrI GAACNNNNNNTAC 2 cut(s) 44, 76
PsyI GACNNNGTC 1 cut(s) 122
RsaI GTAC 4 cut(s) 53, 68, 405, 493
RsaNI GTAC 4 cut(s) 52, 67, 404, 492
SaqAI TTAA 4 cut(s) 17, 444, 483, 573
Sau3AI GATC 1 cut(s) 460
Sau96I GGNCC 2 cut(s) 166, 182
ScaI AGTACT 2 cut(s) 405, 493
ScrFI CCNGG 5 cut(s) 89, 122, 131, 148, 431
SduI GDGCHC 1 cut(s) 207
SetI ASST 7 cut(s) 112, 192, 210, 276, 283, 293, 332
SfaNI GCATC 2 cut(s) 82, 550
Sse9I AATT 1 cut(s) 628
SspMI CTAG 3 cut(s) 170, 360, 566
StyD4I CCNGG 5 cut(s) 87, 120, 129, 146, 429
TaaI ACNGT 2 cut(s) 137, 216
TaiI ACGT 2 cut(s) 192, 293
TaqI TCGA 2 cut(s) 95, 105
TasI AATT 1 cut(s) 628
TatI WGTACW 2 cut(s) 403, 491
TfiI GAWTC 6 cut(s) 92, 97, 143, 319, 434, 551
Tru1I TTAA 4 cut(s) 17, 444, 483, 573
Tru9I TTAA 4 cut(s) 17, 444, 483, 573
TspGWI ACGGA 1 cut(s) 286
Tth111I GACNNNGTC 1 cut(s) 122
VneI GTGCAC 1 cut(s) 203
XagI CCTNNNNNAGG 1 cut(s) 161
XapI RAATTY 1 cut(s) 628
XbaI TCTAGA 1 cut(s) 565
XspI CTAG 3 cut(s) 170, 360, 566
ZrmI AGTACT 2 cut(s) 405, 493
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.