Rmu_ssc0000388.1_g000044

Thioredoxin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000388.1
OG0009565
Physical Location & Seq
Reverse (-)
211553 .. 212122
570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000388.1_g000044.1.cds

Sequence Viewer

Length: 327 bp
atggagaggtattacaatgctcaaacgcgcaacatttctagggcttccattgtggatgacttagtgaagcaactaacagcagtacttgggaactcttatcatagttccctggaatcaggctttaatgaccggaaaactgatctcacaacaagggtttcctttaagtatagtacttcaagaggggtgtatggaacgcctactttctatgtaaatggatttgtattgcctgattctggtgatgctctagattttaacgggtggaaaaaagtgattgacccattagttacggcaccaaagaaacaggaaaatttgcatttcttcttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thioredoxin_4

Protein Analysis

108

Amino Acids

12.23

Weight (kDa)

8.93

Isoelectric Point (pI)

25.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 325
AccB1I GGYRCC 1 cut(s) 289
AccII CGCG 1 cut(s) 28
AcsI RAATTY 1 cut(s) 307
AfaI GTAC 2 cut(s) 84, 172
AfiI CCNNNNNNNGG 1 cut(s) 233
AgsI TTSAA 1 cut(s) 177
AjnI CCWGG 1 cut(s) 108
ApoI RAATTY 1 cut(s) 307
AspLEI GCGC 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 248
BanI GGYRCC 1 cut(s) 289
BceAI ACGGC 1 cut(s) 303
BciT130I CCWGG 1 cut(s) 110
BfaI CTAG 2 cut(s) 39, 245
BmcAI AGTACT 2 cut(s) 84, 172
Bme1390I CCNGG 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 291
BmrFI CCNGG 1 cut(s) 110
BmsI GCATC 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 108
BsaWI WCCGGW 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 233
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 233
Bsh1236I CGCG 1 cut(s) 28
BshNI GGYRCC 1 cut(s) 289
BsiSI CCGG 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 233
Bsp143I GATC 1 cut(s) 139
BspFNI CGCG 1 cut(s) 28
BspLI GGNNCC 1 cut(s) 291
BspT107I GGYRCC 1 cut(s) 289
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 139
Bst2UI CCWGG 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 61
BstF5I GGATG 1 cut(s) 61
BstFNI CGCG 1 cut(s) 28
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BstUI CGCG 1 cut(s) 28
BtsCI GGATG 1 cut(s) 61
CfoI GCGC 1 cut(s) 30
Csp6I GTAC 2 cut(s) 83, 171
CviJI RGCY 2 cut(s) 44, 120
CviKI_1 RGCY 2 cut(s) 44, 120
CviQI GTAC 2 cut(s) 83, 171
DdeI CTNAG 1 cut(s) 61
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 108
FaiI YATR 5 cut(s) 102, 168, 189, 207, 325
FokI GGATG 1 cut(s) 68
FspBI CTAG 2 cut(s) 39, 245
GlaI GCGC 1 cut(s) 29
HapII CCGG 1 cut(s) 130
HhaI GCGC 1 cut(s) 30
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 2 cut(s) 113, 230
HpaII CCGG 1 cut(s) 130
HphI GGTGA 1 cut(s) 248
Hpy188III TCNNGA 2 cut(s) 177, 245
HpyCH4V TGCA 1 cut(s) 313
HpyF3I CTNAG 1 cut(s) 61
HspAI GCGC 1 cut(s) 28
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 7 cut(s) 95, 102, 122, 143, 219, 240, 287
LweI GCATC 1 cut(s) 229
MaeI CTAG 2 cut(s) 39, 245
MaeIII GTNAC 1 cut(s) 283
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 310
MluCI AATT 1 cut(s) 307
MnlI CCTC 1 cut(s) 173
MseI TTAA 3 cut(s) 123, 162, 252
MspI CCGG 1 cut(s) 130
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
MvnI CGCG 1 cut(s) 28
NdeII GATC 1 cut(s) 139
NlaIV GGNNCC 1 cut(s) 291
PfeI GAWTC 2 cut(s) 113, 230
PsiI TTATAA 1 cut(s) 325
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspN4I GGNNCC 1 cut(s) 291
RsaI GTAC 2 cut(s) 84, 172
RsaNI GTAC 2 cut(s) 83, 171
SaqAI TTAA 3 cut(s) 123, 162, 252
Sau3AI GATC 1 cut(s) 139
ScaI AGTACT 2 cut(s) 84, 172
ScrFI CCNGG 1 cut(s) 110
SetI ASST 1 cut(s) 11
SfaNI GCATC 1 cut(s) 229
Sse9I AATT 1 cut(s) 307
SspMI CTAG 2 cut(s) 39, 245
StyD4I CCNGG 1 cut(s) 108
TasI AATT 1 cut(s) 307
TatI WGTACW 2 cut(s) 82, 170
TfiI GAWTC 2 cut(s) 113, 230
Tru1I TTAA 3 cut(s) 123, 162, 252
Tru9I TTAA 3 cut(s) 123, 162, 252
XapI RAATTY 1 cut(s) 307
XbaI TCTAGA 1 cut(s) 244
XspI CTAG 2 cut(s) 39, 245
ZrmI AGTACT 2 cut(s) 84, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.