Rmu_sc0008812.1_g000013

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008812.1
OG0005882
Physical Location & Seq
Reverse (-)
62239 .. 65157
2919 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008812.1_g000013.1.cds

Sequence Viewer

Length: 450 bp
atggaggagatgatggaggcggcgcgtgtgtttcacgagctgccgagggaggagaaggcggagtactatagtagggagatggggatgaaggtcaagtactactctagcagtaccatgtatgatttgatgtttgctgattggaaggacactttgcggtgtatcataactgacgagcagtttgatcctcaagaaattcctctcgtttgcagcctgggccgaaaacagagcaaggagtctccgactccattctccctcctccggccaccaaaccacctcccatggtttcgtctcgaccttgcgcagctgccaatggcagccttgcaccgtggcacaacttgtagcggcagcaggaagcttgtttccatttccgaccgttttgagtacgaagtgaatatctcgtgctacaggccaccaaaactcgaggttcttggcttgttgaacttaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

149

Amino Acids

17.38

Weight (kDa)

5.95

Isoelectric Point (pI)

50.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 300
AccII CGCG 1 cut(s) 25
AciI CCGC 4 cut(s) 20, 59, 154, 342
AclWI GGATC 1 cut(s) 176
AcoI YGGCCR 1 cut(s) 260
AcsI RAATTY 1 cut(s) 192
AfaI GTAC 4 cut(s) 65, 98, 112, 383
AfiI CCNNNNNNNGG 1 cut(s) 258
AgsI TTSAA 1 cut(s) 439
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 3 cut(s) 40, 304, 355
AluI AGCT 3 cut(s) 40, 304, 355
Alw26I GTCTC 2 cut(s) 240, 293
AlwI GGATC 1 cut(s) 176
Ama87I CYCGRG 1 cut(s) 419
AoxI GGCC 3 cut(s) 214, 260, 407
ApeKI GCWGC 6 cut(s) 40, 207, 301, 304, 314, 345
ApoI RAATTY 1 cut(s) 192
ArsI GACNNNNNNTTYG 2 cut(s) 161, 193
AspLEI GCGC 2 cut(s) 25, 301
AspS9I GGNCC 1 cut(s) 214
AvaI CYCGRG 1 cut(s) 419
BarI GAAGNNNNNNTAC 4 cut(s) 47, 79, 80, 112
BauI CACGAG 2 cut(s) 35, 397
BbvI GCAGC 6 cut(s) 27, 219, 291, 313, 326, 357
BccI CCATC 2 cut(s) 7, 73
BciT130I CCWGG 1 cut(s) 212
BcoDI GTCTC 2 cut(s) 240, 293
BfaI CTAG 1 cut(s) 105
BfmI CTRYAG 2 cut(s) 67, 403
BisI GCNGC 8 cut(s) 21, 41, 208, 302, 305, 315, 343, 346
BlsI GCNGC 8 cut(s) 22, 42, 209, 303, 306, 316, 344, 347
BmcAI AGTACT 2 cut(s) 65, 98
Bme1390I CCNGG 1 cut(s) 212
BmeT110I CYCGRG 1 cut(s) 419
BmgT120I GGNCC 1 cut(s) 214
BmrFI CCNGG 1 cut(s) 212
BpuEI CTTGAG 1 cut(s) 171
BsaJI CCNNGG 4 cut(s) 44, 211, 278, 325
Bsc4I CCNNNNNNNGG 1 cut(s) 258
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 4 cut(s) 44, 211, 278, 325
BseGI GGATG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 258
BseRI GAGGAG 3 cut(s) 20, 65, 245
BseXI GCAGC 6 cut(s) 27, 219, 291, 313, 326, 357
Bsh1236I CGCG 1 cut(s) 25
Bsh1285I CGRYCG 1 cut(s) 373
BshFI GGCC 3 cut(s) 216, 262, 409
BsiEI CGRYCG 1 cut(s) 373
BsiHKCI CYCGRG 1 cut(s) 419
BsiSI CCGG 1 cut(s) 259
BslI CCNNNNNNNGG 1 cut(s) 258
BsmAI GTCTC 2 cut(s) 240, 293
BsmBI CGTCTC 1 cut(s) 293
BsnI GGCC 3 cut(s) 216, 262, 409
BsoBI CYCGRG 1 cut(s) 419
Bsp143I GATC 1 cut(s) 181
Bsp19I CCATGG 1 cut(s) 278
BspACI CCGC 4 cut(s) 20, 59, 154, 342
BspANI GGCC 3 cut(s) 216, 262, 409
BspFNI CGCG 1 cut(s) 25
BspPI GGATC 1 cut(s) 176
BssECI CCNNGG 4 cut(s) 44, 211, 278, 325
BssMI GATC 1 cut(s) 181
BssSI CACGAG 2 cut(s) 35, 397
BssT1I CCWWGG 1 cut(s) 278
Bst2BI CACGAG 2 cut(s) 35, 397
Bst2UI CCWGG 1 cut(s) 212
Bst4CI ACNGT 2 cut(s) 326, 374
BstDSI CCRYGG 2 cut(s) 278, 325
BstF5I GGATG 1 cut(s) 90
BstFNI CGCG 1 cut(s) 25
BstHHI GCGC 2 cut(s) 25, 301
BstKTI GATC 1 cut(s) 184
BstMAI GTCTC 2 cut(s) 240, 293
BstMBI GATC 1 cut(s) 181
BstMCI CGRYCG 1 cut(s) 373
BstMWI GCNNNNNNNGC 1 cut(s) 213
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstSFI CTRYAG 2 cut(s) 67, 403
BstUI CGCG 1 cut(s) 25
BstV1I GCAGC 6 cut(s) 27, 219, 291, 313, 326, 357
BsuRI GGCC 3 cut(s) 216, 262, 409
BtgI CCRYGG 2 cut(s) 278, 325
BtsCI GGATG 1 cut(s) 90
CfoI GCGC 2 cut(s) 25, 301
Cfr13I GGNCC 1 cut(s) 214
Csp6I GTAC 4 cut(s) 64, 97, 111, 382
CviAII CATG 2 cut(s) 115, 279
CviJI RGCY 9 cut(s) 40, 210, 216, 262, 304, 317, 355, 409, 432
CviKI_1 RGCY 9 cut(s) 40, 210, 216, 262, 304, 317, 355, 409, 432
CviQI GTAC 4 cut(s) 64, 97, 111, 382
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
EaeI YGGCCR 1 cut(s) 260
EciI GGCGGA 1 cut(s) 74
Eco130I CCWWGG 1 cut(s) 278
Eco88I CYCGRG 1 cut(s) 419
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 278
ErhI CCWWGG 1 cut(s) 278
Esp3I CGTCTC 1 cut(s) 293
FaeI CATG 2 cut(s) 118, 282
FaiI YATR 5 cut(s) 69, 116, 120, 164, 280
FatI CATG 2 cut(s) 114, 278
Fnu4HI GCNGC 8 cut(s) 21, 41, 208, 302, 305, 315, 343, 346
FokI GGATG 1 cut(s) 97
Fsp4HI GCNGC 8 cut(s) 21, 41, 208, 302, 305, 315, 343, 346
FspBI CTAG 1 cut(s) 105
FspI TGCGCA 1 cut(s) 300
GlaI GCGC 2 cut(s) 24, 300
GluI GCNGC 8 cut(s) 21, 41, 208, 302, 305, 315, 343, 346
HaeIII GGCC 3 cut(s) 216, 262, 409
HapII CCGG 1 cut(s) 259
HhaI GCGC 2 cut(s) 25, 301
Hin1II CATG 2 cut(s) 118, 282
Hin6I GCGC 2 cut(s) 23, 299
HinP1I GCGC 2 cut(s) 23, 299
HindIII AAGCTT 1 cut(s) 353
HinfI GANTC 2 cut(s) 233, 241
HpaII CCGG 1 cut(s) 259
Hpy188I TCNGA 2 cut(s) 240, 370
Hpy188III TCNNGA 3 cut(s) 35, 188, 290
HpyAV CCTTC 3 cut(s) 49, 82, 136
HpyCH4III ACNGT 2 cut(s) 326, 374
HpyCH4V TGCA 2 cut(s) 207, 322
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
Hsp92II CATG 2 cut(s) 118, 282
HspAI GCGC 2 cut(s) 23, 299
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 5 cut(s) 197, 224, 272, 334, 391
Lsp1109I GCAGC 6 cut(s) 27, 219, 291, 313, 326, 357
MaeI CTAG 1 cut(s) 105
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MluCI AATT 1 cut(s) 192
MlyI GAGTC 2 cut(s) 235, 242
MmeI TCCRAC 2 cut(s) 263, 393
MnlI CCTC 9 cut(s) 10, 39, 43, 195, 207, 263, 266, 284, 415
MspA1I CMGCKG 1 cut(s) 304
MspI CCGG 1 cut(s) 259
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
MvnI CGCG 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 213
NcoI CCATGG 1 cut(s) 278
NdeII GATC 1 cut(s) 181
NlaIII CATG 2 cut(s) 118, 282
NmeAIII GCCGAG 1 cut(s) 69
NsbI TGCGCA 1 cut(s) 300
PaeR7I CTCGAG 1 cut(s) 419
PkrI GCNGC 8 cut(s) 22, 42, 209, 303, 306, 316, 344, 347
PleI GAGTC 2 cut(s) 235, 241
PpsI GAGTC 2 cut(s) 235, 241
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspPI GGNCC 1 cut(s) 214
PspXI VCTCGAGB 1 cut(s) 419
PvuII CAGCTG 1 cut(s) 304
RsaI GTAC 4 cut(s) 65, 98, 112, 383
RsaNI GTAC 4 cut(s) 64, 97, 111, 382
SatI GCNGC 8 cut(s) 21, 41, 208, 302, 305, 315, 343, 346
Sau3AI GATC 1 cut(s) 181
Sau96I GGNCC 1 cut(s) 214
ScaI AGTACT 2 cut(s) 65, 98
SchI GAGTC 2 cut(s) 235, 242
ScrFI CCNGG 1 cut(s) 212
SetI ASST 8 cut(s) 42, 93, 276, 297, 306, 357, 426, 448
SfcI CTRYAG 2 cut(s) 67, 403
Sfr274I CTCGAG 1 cut(s) 419
SlaI CTCGAG 1 cut(s) 419
SmlI CTYRAG 2 cut(s) 186, 419
SmoI CTYRAG 2 cut(s) 186, 419
Sse9I AATT 1 cut(s) 192
SsiI CCGC 4 cut(s) 20, 59, 154, 342
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 278
TaaI ACNGT 2 cut(s) 326, 374
TaqI TCGA 2 cut(s) 291, 420
TasI AATT 1 cut(s) 192
TatI WGTACW 2 cut(s) 63, 96
TauI GCSGC 2 cut(s) 23, 345
TseI GCWGC 6 cut(s) 40, 207, 301, 304, 314, 345
TspDTI ATGAA 1 cut(s) 101
XapI RAATTY 1 cut(s) 192
XhoI CTCGAG 1 cut(s) 419
XspI CTAG 1 cut(s) 105
ZrmI AGTACT 2 cut(s) 65, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.