Rmu_sc0009774.1_g000011

Thaumatin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009774.1
OG0009846
Physical Location & Seq
Forward (+)
32855 .. 33277
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009774.1_g000011.1.cds

Sequence Viewer

Length: 345 bp
atggctttcagtcgattttcaaagctcgtagtctctctctgtctcattcacttcatttcaggtggttactcggcaacgtttacgattacaaacaagtgcagcaacacaatttggccgggcattttgtcaaacgccgggacggcgcagctttctactaccgggtttgctttacaatctggggagtctagctcgatagccgttccggcctcgtggtcgggtaggctatgggggcggactctgtgctccaaggacccgaccacgggaaagttcagttgcgttacgggagattgtggctccggtactgtcgagtgtgccggaggtggagctgctccattggtatggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

114

Amino Acids

11.71

Weight (kDa)

8.64

Isoelectric Point (pI)

35.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009846)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G17860 AT4G36010 AT4G36010
fragaria_vesca FvH4_1g11720 FvH4_1g11720
malus_domestica MD02G1130400.v1.1 MD15G1244300.v1.1
prunus_persica Prupe.7G169400_v2.0.a1
pyrus_communis pycom02g10210 pycom02g10230
rosa_chinensis RchiOBHm_Chr2g0099311
rosa_laevigata RLG00000016870
rosa_multiflora Rmu_sc0009774.1_g000011 Rmu_sc0009774.1_g000013
rosa_roxburghii Rroxscaffold_2G00143220
rosa_rugosa Rorug02G0078600
rosa_samantha Rh2AG128000 Rh2BG130900 Rh2CG132100 Rh2DG132600
rosa_wichuraiana Rw2G009880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AclI AACGTT 1 cut(s) 77
AcoI YGGCCR 1 cut(s) 113
AfaI GTAC 1 cut(s) 301
AfiI CCNNNNNNNGG 2 cut(s) 259, 260
AgsI TTSAA 1 cut(s) 21
AluBI AGCT 4 cut(s) 25, 148, 189, 326
AluI AGCT 4 cut(s) 25, 148, 189, 326
Alw21I GWGCWC 1 cut(s) 245
Alw26I GTCTC 2 cut(s) 37, 47
AoxI GGCC 2 cut(s) 113, 204
ApeKI GCWGC 3 cut(s) 99, 145, 326
AspLEI GCGC 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 250
AsuC2I CCSGG 3 cut(s) 117, 136, 160
AvaII GGWCC 1 cut(s) 250
BauI CACGAG 1 cut(s) 208
Bbv12I GWGCWC 1 cut(s) 245
BbvI GCAGC 3 cut(s) 111, 157, 313
BceAI ACGGC 2 cut(s) 156, 182
BcnI CCSGG 3 cut(s) 117, 136, 160
BcoDI GTCTC 2 cut(s) 37, 47
BfaI CTAG 1 cut(s) 186
BglI GCCNNNNNGGC 2 cut(s) 140, 203
BisI GCNGC 3 cut(s) 100, 146, 327
BlsI GCNGC 3 cut(s) 101, 147, 328
Bme1390I CCNGG 3 cut(s) 117, 136, 160
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BmiI GGNNCC 2 cut(s) 252, 295
BmrFI CCNGG 3 cut(s) 117, 136, 160
BplI GAGNNNNNCTC 2 cut(s) 173, 205
BpuMI CCSGG 3 cut(s) 117, 136, 160
BsaJI CCNNGG 2 cut(s) 246, 258
BsaWI WCCGGW 1 cut(s) 296
Bsc4I CCNNNNNNNGG 2 cut(s) 259, 260
BseDI CCNNGG 2 cut(s) 246, 258
BseLI CCNNNNNNNGG 2 cut(s) 259, 260
BseXI GCAGC 3 cut(s) 111, 157, 313
BsgI GTGCAG 1 cut(s) 118
BshFI GGCC 2 cut(s) 115, 206
BsiHKAI GWGCWC 1 cut(s) 245
BsiSI CCGG 6 cut(s) 116, 135, 159, 203, 297, 315
BslFI GGGAC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 259, 260
BsmAI GTCTC 2 cut(s) 37, 47
BsmFI GGGAC 1 cut(s) 151
BsnI GGCC 2 cut(s) 115, 206
Bsp1286I GDGCHC 1 cut(s) 245
BspACI CCGC 1 cut(s) 232
BspANI GGCC 2 cut(s) 115, 206
BspLI GGNNCC 2 cut(s) 252, 295
BssECI CCNNGG 2 cut(s) 246, 258
BssSI CACGAG 1 cut(s) 208
BssT1I CCWWGG 1 cut(s) 246
Bst2BI CACGAG 1 cut(s) 208
Bst4CI ACNGT 1 cut(s) 304
BstDSI CCRYGG 1 cut(s) 258
BstHHI GCGC 1 cut(s) 145
BstMAI GTCTC 2 cut(s) 37, 47
BstMWI GCNNNNNNNGC 3 cut(s) 140, 203, 229
BstSCI CCNGG 3 cut(s) 115, 134, 158
BstV1I GCAGC 3 cut(s) 111, 157, 313
BstXI CCANNNNNNTGG 1 cut(s) 339
BsuRI GGCC 2 cut(s) 115, 206
BtgI CCRYGG 1 cut(s) 258
CfoI GCGC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 250
Csp6I GTAC 1 cut(s) 300
CviQI GTAC 1 cut(s) 300
EaeI YGGCCR 1 cut(s) 113
EciI GGCGGA 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 246
Eco47I GGWCC 1 cut(s) 250
EcoO109I RGGNCCY 1 cut(s) 250
EcoT14I CCWWGG 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 246
FaiI YATR 2 cut(s) 226, 340
FaqI GGGAC 1 cut(s) 151
Fnu4HI GCNGC 3 cut(s) 100, 146, 327
Fsp4HI GCNGC 3 cut(s) 100, 146, 327
FspBI CTAG 1 cut(s) 186
GlaI GCGC 1 cut(s) 144
GluI GCNGC 3 cut(s) 100, 146, 327
HaeIII GGCC 2 cut(s) 115, 206
HapII CCGG 6 cut(s) 116, 135, 159, 203, 297, 315
HhaI GCGC 1 cut(s) 145
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HinfI GANTC 2 cut(s) 182, 235
HpaII CCGG 6 cut(s) 116, 135, 159, 203, 297, 315
Hpy166II GTNNAC 1 cut(s) 81
Hpy8I GTNNAC 1 cut(s) 81
HpyCH4III ACNGT 1 cut(s) 304
HpyCH4IV ACGT 1 cut(s) 77
HpyCH4V TGCA 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 3 cut(s) 140, 203, 229
HpySE526I ACGT 1 cut(s) 77
HspAI GCGC 1 cut(s) 143
LmnI GCTCC 4 cut(s) 248, 299, 323, 334
LpnPI CCDG 8 cut(s) 45, 129, 148, 162, 172, 216, 310, 328
Lsp1109I GCAGC 3 cut(s) 111, 157, 313
MaeI CTAG 1 cut(s) 186
MaeII ACGT 1 cut(s) 77
MaeIII GTNAC 2 cut(s) 65, 277
MhlI GDGCHC 1 cut(s) 245
MluCI AATT 1 cut(s) 108
MlyI GAGTC 2 cut(s) 191, 229
MnlI CCTC 2 cut(s) 217, 311
MslI CAYNNNNRTG 1 cut(s) 337
MspI CCGG 6 cut(s) 116, 135, 159, 203, 297, 315
MspR9I CCNGG 3 cut(s) 117, 136, 160
MwoI GCNNNNNNNGC 3 cut(s) 140, 203, 229
NciI CCSGG 3 cut(s) 117, 136, 160
NlaIV GGNNCC 2 cut(s) 252, 295
NmeAIII GCCGAG 1 cut(s) 50
PkrI GCNGC 3 cut(s) 101, 147, 328
PleI GAGTC 2 cut(s) 190, 229
PpsI GAGTC 2 cut(s) 190, 229
PpuMI RGGWCCY 1 cut(s) 250
Psp1406I AACGTT 1 cut(s) 77
Psp5II RGGWCCY 1 cut(s) 250
PspN4I GGNNCC 2 cut(s) 252, 295
PspPI GGNCC 1 cut(s) 250
PspPPI RGGWCCY 1 cut(s) 250
RsaI GTAC 1 cut(s) 301
RsaNI GTAC 1 cut(s) 300
RseI CAYNNNNRTG 1 cut(s) 337
SatI GCNGC 3 cut(s) 100, 146, 327
Sau96I GGNCC 1 cut(s) 250
SchI GAGTC 2 cut(s) 191, 229
ScrFI CCNGG 3 cut(s) 117, 136, 160
SduI GDGCHC 1 cut(s) 245
SetI ASST 7 cut(s) 27, 64, 80, 150, 191, 322, 328
SinI GGWCC 1 cut(s) 250
SmiMI CAYNNNNRTG 1 cut(s) 337
Sse9I AATT 1 cut(s) 108
SsiI CCGC 1 cut(s) 232
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 3 cut(s) 115, 134, 158
StyI CCWWGG 1 cut(s) 246
TaaI ACNGT 1 cut(s) 304
TaiI ACGT 1 cut(s) 80
TaqI TCGA 3 cut(s) 13, 191, 306
TasI AATT 1 cut(s) 108
TseI GCWGC 3 cut(s) 99, 145, 326
TspDTI ATGAA 1 cut(s) 43
VpaK11BI GGWCC 1 cut(s) 250
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.