Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010162.1

Orthogroup ID

OG0009796

Physical Location & Seq

Genomic Coordinates Reverse (-)

30410 .. 34639

Gene Structure 4230 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010162.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atgtcttggaagctgagaggagtagagccagcttcaaggagtgcagtgtctcgaagatggaccattttgttttgtattgcttgtttctgtgctgggatgctcttctctgatagaatgtggtcagtgccggaaataaaaggcatgtcaaggacaacaagggttgatggtgacaatctgaagttagtatctggttgtgatccatccaataaggatgtagaacaggaatcaactgatgtttacggggaagtttcaaagactcatcatgctatacaaacactggataaaacaatttcaaatttggagatggaattagcagctgcaaaggctgctcaggaatctatacttaacgggtcaccggttgcaggagatttaaaagtctctgagtccaccaagaaaagaaaatatttgatggttgtcggaatcaatactgcttttagcagtagaaagcgtagagattcagtccgtactacttggatgcctcaaggcgataaaagaaagaagcttgaggaagagaagggaattgtagttcgctttgtaataggtcacagtgctacatcaggtggtatccttgatagagctgttgaggccgaggacaaaagacacggtgacattatgcggctggaccatgttgagggttacctcgaattatcagcaaagaccaagatattttttgctactgctgttactacatgggatgcagagttctatgtcaaagttgatgatgatgtacatgtaaatataggaacacttggagcaactttagctagacatcggtcaaagcccagggtgtacattggatgcatgaaatccggtcccgtccttgctcaaaagggagtgaggtatcatgagcccgagtactggaagttcggcgaggaagggaacaagtattttcgtcatgccaccggccagctctatgctatctcaagagacttggctacttacatctccatcaaccagcatgttctacacaagtatgtcaatgaggatgtttctctgggttcatggttactgggattggatgtggagcatattgatgaccgaagattatgttgtggaacaccgcctgattgtgaatggaaggcccaggctggcaatgtctgtgttgcttcatttgattggacttgtagcgggatttgcaagtctgctgagaggatcaaagaggtccatcgacgctgtggagaaggcgagaatgctttgtggagtgcagttttctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4094 Galactosyl_T

Protein Analysis

404

Amino Acids

45.26

Weight (kDa)

8.35

Isoelectric Point (pI)

42.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009796)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26940 AT4G26940
fragaria_vesca	FvH4_3g22900 FvH4_3g22900 FvH4_3g22900
malus_domestica	MD03G1199500.v1.1 MD11G1216400.v1.1
prunus_persica	Prupe.4G215100_v2.0.a1
pyrus_communis	pycom03g15110 pycom11g19050
rosa_chinensis	RchiOBHm_Chr5g0040251
rosa_laevigata	RLG00000033965
rosa_multiflora	Rmu_sc0002908.1_g000013 Rmu_sc0010162.1_g000007
rosa_roxburghii	Rroxscaffold_1G00041080
rosa_rugosa	Rorug05G0184100
rosa_samantha	Rh5AG271000 Rh5BG274300 Rh5CG307200 Rh5DG282500
rosa_wichuraiana	Rw5G025340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	616, 1061, 1128
AclWI	GGATC	2 cut(s)	191, 1160
AcoI	YGGCCR	1 cut(s)	904
AcsI	RAATTY	1 cut(s)	295
AcuI	CTGAAG	1 cut(s)	197
AfaI	GTAC	4 cut(s)	466, 729, 791, 857
AfiI	CCNNNNNNNGG	3 cut(s)	362, 631, 858
AflIII	ACRYGT	1 cut(s)	730
AgeI	ACCGGT	1 cut(s)	355
AgsI	TTSAA	3 cut(s)	36, 252, 294
AjnI	CCWGG	2 cut(s)	782, 1083
AloI	GAACNNNNNNTCC	4 cut(s)	510, 542, 686, 718
AluBI	AGCT	7 cut(s)	13, 32, 317, 502, 578, 764, 910
AluI	AGCT	7 cut(s)	13, 32, 317, 502, 578, 764, 910
Alw26I	GTCTC	3 cut(s)	54, 382, 921
AlwI	GGATC	2 cut(s)	191, 1160
Ama87I	CYCGRG	1 cut(s)	851
AoxI	GGCC	3 cut(s)	585, 904, 1080
ApeKI	GCWGC	3 cut(s)	314, 317, 326
ApoI	RAATTY	1 cut(s)	295
AsiGI	ACCGGT	1 cut(s)	355
AspS9I	GGNCC	5 cut(s)	60, 622, 812, 1081, 1162
AsuHPI	GGTGA	3 cut(s)	179, 345, 617
AvaI	CYCGRG	1 cut(s)	851
AvaII	GGWCC	4 cut(s)	60, 622, 812, 1162
BanII	GRGCYC	1 cut(s)	852
BbvI	GCAGC	3 cut(s)	304, 313, 326
BccI	CCATC	7 cut(s)	51, 158, 208, 298, 403, 956, 1173
BciT130I	CCWGG	2 cut(s)	784, 1085
BciVI	GTATCC	1 cut(s)	575
BcoDI	GTCTC	3 cut(s)	54, 382, 921
BfaI	CTAG	1 cut(s)	765
BfuI	GTATCC	1 cut(s)	575
BisI	GCNGC	4 cut(s)	315, 318, 327, 617
BlsI	GCNGC	4 cut(s)	316, 319, 328, 618
BmcAI	AGTACT	1 cut(s)	857
Bme1390I	CCNGG	2 cut(s)	784, 1085
Bme18I	GGWCC	4 cut(s)	60, 622, 812, 1162
BmeT110I	CYCGRG	1 cut(s)	851
BmgT120I	GGNCC	5 cut(s)	60, 622, 812, 1081, 1162
BmiI	GGNNCC	1 cut(s)	814
BmrFI	CCNGG	2 cut(s)	784, 1085
BmrI	ACTGGG	1 cut(s)	1019
BmsI	GCATC	4 cut(s)	87, 465, 685, 788
BmuI	ACTGGG	1 cut(s)	1019
BoxI	GACNNNNGTC	1 cut(s)	772
Bpu10I	CCTNAGC	1 cut(s)	330
BpuEI	CTTGAG	3 cut(s)	465, 524, 907
BsaJI	CCNNGG	4 cut(s)	588, 782, 783, 1083
BsaWI	WCCGGW	2 cut(s)	355, 809
Bsc4I	CCNNNNNNNGG	3 cut(s)	362, 631, 858
Bse118I	RCCGGY	2 cut(s)	355, 902
Bse1I	ACTGG	3 cut(s)	282, 863, 1014
Bse3DI	GCAATG	1 cut(s)	1099
BseBI	CCWGG	2 cut(s)	784, 1085
BseDI	CCNNGG	4 cut(s)	588, 782, 783, 1083
BseGI	GGATG	8 cut(s)	102, 200, 217, 480, 700, 803, 991, 1024
BseLI	CCNNNNNNNGG	3 cut(s)	362, 631, 858
BseMI	GCAATG	1 cut(s)	1099
BseMII	CTCAG	4 cut(s)	5, 344, 372, 1137
BseNI	ACTGG	3 cut(s)	282, 863, 1014
BseRI	GAGGAG	1 cut(s)	33
BseXI	GCAGC	3 cut(s)	304, 313, 326
BseYI	CCCAGC	1 cut(s)	92
BsgI	GTGCAG	1 cut(s)	63
BshFI	GGCC	3 cut(s)	587, 906, 1082
BshTI	ACCGGT	1 cut(s)	355
BsiHKCI	CYCGRG	1 cut(s)	851
BsiSI	CCGG	4 cut(s)	128, 356, 810, 903
BslFI	GGGAC	1 cut(s)	798
BslI	CCNNNNNNNGG	3 cut(s)	362, 631, 858
BsmAI	GTCTC	3 cut(s)	54, 382, 921
BsmFI	GGGAC	1 cut(s)	798
BsmI	GAATGC	1 cut(s)	1195
BsnI	GGCC	3 cut(s)	587, 906, 1082
BsoBI	CYCGRG	1 cut(s)	851
Bsp1286I	GDGCHC	1 cut(s)	852
Bsp1407I	TGTACA	2 cut(s)	727, 789
Bsp143I	GATC	2 cut(s)	196, 1152
BspACI	CCGC	3 cut(s)	616, 1061, 1128
BspANI	GGCC	3 cut(s)	587, 906, 1082
BspCNI	CTCAG	4 cut(s)	6, 343, 373, 1138
BspHI	TCATGA	1 cut(s)	844
BspLI	GGNNCC	1 cut(s)	814
BspPI	GGATC	2 cut(s)	191, 1160
BspQI	GCTCTTC	1 cut(s)	107
BsrDI	GCAATG	1 cut(s)	1099
BsrFI	RCCGGY	2 cut(s)	355, 902
BsrGI	TGTACA	2 cut(s)	727, 789
BsrI	ACTGG	3 cut(s)	282, 863, 1014
BssAI	RCCGGY	2 cut(s)	355, 902
BssECI	CCNNGG	4 cut(s)	588, 782, 783, 1083
BssMI	GATC	2 cut(s)	196, 1152
Bst2UI	CCWGG	2 cut(s)	784, 1085
Bst4CI	ACNGT	2 cut(s)	548, 605
Bst6I	CTCTTC	2 cut(s)	107, 504
BstAPI	GCANNNNNTGC	1 cut(s)	326
BstAUI	TGTACA	2 cut(s)	727, 789
BstC8I	GCNNGC	3 cut(s)	30, 908, 1090
BstDEI	CTNAG	4 cut(s)	14, 330, 381, 1146
BstEII	GGTNACC	2 cut(s)	351, 635
BstF5I	GGATG	8 cut(s)	102, 200, 217, 480, 700, 803, 991, 1024
BstKTI	GATC	2 cut(s)	199, 1155
BstMAI	GTCTC	3 cut(s)	54, 382, 921
BstMBI	GATC	2 cut(s)	196, 1152
BstMWI	GCNNNNNNNGC	5 cut(s)	323, 326, 584, 761, 1134
BstNI	CCWGG	2 cut(s)	784, 1085
BstNSI	RCATGY	3 cut(s)	145, 734, 962
BstPAI	GACNNNNGTC	1 cut(s)	772
BstPI	GGTNACC	2 cut(s)	351, 635
BstSCI	CCNGG	2 cut(s)	782, 1083
BstV1I	GCAGC	3 cut(s)	304, 313, 326
BsuI	GTATCC	1 cut(s)	575
BsuRI	GGCC	3 cut(s)	587, 906, 1082
BtsCI	GGATG	8 cut(s)	102, 200, 217, 480, 700, 803, 991, 1024
BtsI	GCAGTG	1 cut(s)	51
BtsIMutI	CAGTG	4 cut(s)	51, 129, 275, 553
Cac8I	GCNNGC	3 cut(s)	30, 908, 1090
CciI	TCATGA	1 cut(s)	844
Cfr10I	RCCGGY	2 cut(s)	355, 902
Cfr13I	GGNCC	5 cut(s)	60, 622, 812, 1081, 1162
CseI	GACGC	1 cut(s)	1179
Csp6I	GTAC	4 cut(s)	465, 728, 790, 856
CspAI	ACCGGT	1 cut(s)	355
CviQI	GTAC	4 cut(s)	465, 728, 790, 856
DdeI	CTNAG	4 cut(s)	14, 330, 381, 1146
DpnI	GATC	2 cut(s)	198, 1154
DpnII	GATC	2 cut(s)	196, 1152
DraI	TTTAAA	1 cut(s)	372
EaeI	YGGCCR	1 cut(s)	904
Eam1104I	CTCTTC	2 cut(s)	107, 504
EarI	CTCTTC	2 cut(s)	107, 504
Eco24I	GRGCYC	1 cut(s)	852
Eco47I	GGWCC	4 cut(s)	60, 622, 812, 1162
Eco57I	CTGAAG	1 cut(s)	197
Eco88I	CYCGRG	1 cut(s)	851
Eco91I	GGTNACC	2 cut(s)	351, 635
EcoO65I	GGTNACC	2 cut(s)	351, 635
EcoRII	CCWGG	2 cut(s)	782, 1083
EcoT22I	ATGCAT	1 cut(s)	803
EcoT38I	GRGCYC	1 cut(s)	852
FaqI	GGGAC	1 cut(s)	798
FauI	CCCGC	1 cut(s)	1121
Fnu4HI	GCNGC	4 cut(s)	315, 318, 327, 617
FokI	GGATG	8 cut(s)	109, 187, 224, 487, 707, 810, 998, 1031
FriOI	GRGCYC	1 cut(s)	852
Fsp4HI	GCNGC	4 cut(s)	315, 318, 327, 617
FspBI	CTAG	1 cut(s)	765
GluI	GCNGC	4 cut(s)	315, 318, 327, 617
GsaI	CCCAGC	1 cut(s)	96
HaeIII	GGCC	3 cut(s)	587, 906, 1082
HapII	CCGG	4 cut(s)	128, 356, 810, 903
HgaI	GACGC	1 cut(s)	1179
HindIII	AAGCTT	1 cut(s)	500
HinfI	GANTC	6 cut(s)	224, 256, 335, 383, 420, 455
HpaII	CCGG	4 cut(s)	128, 356, 810, 903
HphI	GGTGA	3 cut(s)	179, 345, 617
Hpy166II	GTNNAC	3 cut(s)	238, 387, 790
Hpy188I	TCNGA	4 cut(s)	109, 177, 382, 419
Hpy188III	TCNNGA	4 cut(s)	51, 332, 845, 924
Hpy8I	GTNNAC	3 cut(s)	238, 387, 790
Hpy99I	CGWCG	1 cut(s)	1173
HpyAV	CCTTC	4 cut(s)	508, 869, 1072, 1175
HpyCH4III	ACNGT	2 cut(s)	548, 605
HpyCH4V	TGCA	7 cut(s)	44, 320, 362, 698, 801, 1137, 1205
HpyF10VI	GCNNNNNNNGC	5 cut(s)	323, 326, 584, 761, 1134
HpyF3I	CTNAG	4 cut(s)	14, 330, 381, 1146
Kzo9I	GATC	2 cut(s)	196, 1152
LguI	GCTCTTC	1 cut(s)	107
LmnI	GCTCC	2 cut(s)	752, 1024
Lsp1109I	GCAGC	3 cut(s)	304, 313, 326
LweI	GCATC	4 cut(s)	87, 465, 685, 788
MaeI	CTAG	1 cut(s)	765
MaeIII	GTNAC	7 cut(s)	167, 351, 542, 605, 635, 682, 1005
MalI	GATC	2 cut(s)	198, 1154
MboI	GATC	2 cut(s)	196, 1152
MboII	GAAGA	4 cut(s)	66, 94, 521, 1053
MhlI	GDGCHC	1 cut(s)	852
MluCI	AATT	5 cut(s)	288, 295, 308, 519, 644
MlyI	GAGTC	2 cut(s)	250, 392
MmeI	TCCRAC	1 cut(s)	397
Mph1103I	ATGCAT	1 cut(s)	803
MseI	TTAA	2 cut(s)	345, 371
MslI	CAYNNNNRTG	2 cut(s)	972, 1032
MspA1I	CMGCKG	1 cut(s)	317
MspI	CCGG	4 cut(s)	128, 356, 810, 903
MspR9I	CCNGG	2 cut(s)	784, 1085
Mva1269I	GAATGC	1 cut(s)	1195
MvaI	CCWGG	2 cut(s)	784, 1085
MwoI	GCNNNNNNNGC	5 cut(s)	323, 326, 584, 761, 1134
NdeII	GATC	2 cut(s)	196, 1152
NlaIV	GGNNCC	1 cut(s)	814
NmeAIII	GCCGAG	1 cut(s)	613
NmuCI	GTSAC	4 cut(s)	167, 351, 542, 605
NsiI	ATGCAT	1 cut(s)	803
NspI	RCATGY	3 cut(s)	145, 734, 962
PagI	TCATGA	1 cut(s)	844
PasI	CCCWGGG	1 cut(s)	783
PciI	ACATGT	1 cut(s)	730
PciSI	GCTCTTC	1 cut(s)	107
PctI	GAATGC	1 cut(s)	1195
PfeI	GAWTC	4 cut(s)	224, 335, 420, 455
PinAI	ACCGGT	1 cut(s)	355
PkrI	GCNGC	4 cut(s)	316, 319, 328, 618
PleI	GAGTC	2 cut(s)	250, 391
PpsI	GAGTC	2 cut(s)	250, 391
PscI	ACATGT	1 cut(s)	730
PshAI	GACNNNNGTC	1 cut(s)	772
Psp6I	CCWGG	2 cut(s)	782, 1083
PspEI	GGTNACC	2 cut(s)	351, 635
PspFI	CCCAGC	1 cut(s)	92
PspGI	CCWGG	2 cut(s)	782, 1083
PspN4I	GGNNCC	1 cut(s)	814
PspPI	GGNCC	5 cut(s)	60, 622, 812, 1081, 1162
PsrI	GAACNNNNNNTAC	2 cut(s)	848, 880
PvuII	CAGCTG	1 cut(s)	317
RsaI	GTAC	4 cut(s)	466, 729, 791, 857
RsaNI	GTAC	4 cut(s)	465, 728, 790, 856
RseI	CAYNNNNRTG	2 cut(s)	972, 1032
SapI	GCTCTTC	1 cut(s)	107
SaqAI	TTAA	2 cut(s)	345, 371
SatI	GCNGC	4 cut(s)	315, 318, 327, 617
Sau3AI	GATC	2 cut(s)	196, 1152
Sau96I	GGNCC	5 cut(s)	60, 622, 812, 1081, 1162
ScaI	AGTACT	1 cut(s)	857
SchI	GAGTC	2 cut(s)	250, 392
ScrFI	CCNGG	2 cut(s)	784, 1085
SduI	GDGCHC	1 cut(s)	852
SfaNI	GCATC	4 cut(s)	87, 465, 685, 788
SinI	GGWCC	4 cut(s)	60, 622, 812, 1162
SmiMI	CAYNNNNRTG	2 cut(s)	972, 1032
SmlI	CTYRAG	3 cut(s)	480, 503, 922
SmoI	CTYRAG	3 cut(s)	480, 503, 922
Sse9I	AATT	5 cut(s)	288, 295, 308, 519, 644
SsiI	CCGC	3 cut(s)	616, 1061, 1128
SspI	AATATT	1 cut(s)	404
SspMI	CTAG	1 cut(s)	765
StyD4I	CCNGG	2 cut(s)	782, 1083
TaaI	ACNGT	2 cut(s)	548, 605
TaqI	TCGA	3 cut(s)	52, 642, 1168
TaqII	GACCGA	2 cut(s)	762, 1053
TasI	AATT	5 cut(s)	288, 295, 308, 519, 644
TatI	WGTACW	3 cut(s)	727, 789, 855
TauI	GCSGC	1 cut(s)	619
TfiI	GAWTC	4 cut(s)	224, 335, 420, 455
Tru1I	TTAA	2 cut(s)	345, 371
Tru9I	TTAA	2 cut(s)	345, 371
TscAI	CASTG	4 cut(s)	51, 129, 282, 553
TseFI	GTSAC	4 cut(s)	167, 351, 542, 605
TseI	GCWGC	3 cut(s)	314, 317, 326
Tsp45I	GTSAC	4 cut(s)	167, 351, 542, 605
TspDTI	ATGAA	3 cut(s)	818, 990, 1098
TspGWI	ACGGA	1 cut(s)	452
TspRI	CASTG	4 cut(s)	51, 129, 282, 553
VpaK11BI	GGWCC	4 cut(s)	60, 622, 812, 1162
XapI	RAATTY	1 cut(s)	295
XceI	RCATGY	3 cut(s)	145, 734, 962
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1172
XspI	CTAG	1 cut(s)	765
ZrmI	AGTACT	1 cut(s)	857
Zsp2I	ATGCAT	1 cut(s)	803

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.