Rmu_sc0010633.1_g000009

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010633.1
Physical Location & Seq
Forward (+)
33449 .. 35593
2145 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010633.1_g000009.1.cds

Sequence Viewer

Length: 654 bp
atggcttctcttcaaatcttcaagtccaccctctctcccagccctgtttcccagtcaagtttcaccggaaaatccaggtgggtcttgtcggaaattcagtccaggaataacagtatcatcaggctctctggttattattacttgaggaggaggaggttcagggtctgctgcaaagctcaagaatcagataacaaaagcaatggggaagaaccgcccgagtcattgtttatgaaggaattgaggaggaggggtatgagtccgacttctttgcttgaggaagcagagaggactgagcgtggaatcagtgatgagaggggcaaaggagatagaggtttctcaaatagaaatgcggtctcaactgaagtggagaaaagcctggctaatcaaagggagcgatccatgcagttgaacagtgaaggcctcgaggggttgatccctcgaggaagactcttgctgacgcttggagggacattcttcttggcattttggccatttatggtcataagtgtagcactattctctgctctctatatctactttggaccaacatttatccatgatgcaaacaacagaatatcaccacctcaatacattgatccgtatgaacttctggaagatgataggatttctcaaatagcccctcgtgtaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

217

Amino Acids

24.8

Weight (kDa)

9.47

Isoelectric Point (pI)

64.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 2 cut(s) 422, 438
AciI CCGC 2 cut(s) 212, 350
AclWI GGATC 3 cut(s) 390, 427, 590
AcoI YGGCCR 1 cut(s) 488
AcsI RAATTY 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 381
AgsI TTSAA 3 cut(s) 14, 22, 409
AjnI CCWGG 3 cut(s) 74, 101, 375
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
Alw26I GTCTC 1 cut(s) 358
AlwI GGATC 3 cut(s) 390, 427, 590
AlwNI CAGNNNCTG 1 cut(s) 165
Ama87I CYCGRG 3 cut(s) 215, 422, 438
AoxI GGCC 2 cut(s) 418, 488
ApeKI GCWGC 1 cut(s) 168
ApoI RAATTY 1 cut(s) 93
AspS9I GGNCC 1 cut(s) 542
AsuHPI GGTGA 2 cut(s) 55, 570
AvaI CYCGRG 3 cut(s) 215, 422, 438
AvaII GGWCC 1 cut(s) 542
BalI TGGCCA 1 cut(s) 490
BauI CACGAG 1 cut(s) 642
BbsI GAAGAC 1 cut(s) 451
BbvI GCAGC 1 cut(s) 155
BcgI CGANNNNNNTGC 2 cut(s) 250, 284
BciT130I CCWGG 3 cut(s) 76, 103, 377
BcoDI GTCTC 1 cut(s) 358
BisI GCNGC 1 cut(s) 169
BlsI GCNGC 1 cut(s) 170
Bme1390I CCNGG 3 cut(s) 76, 103, 377
Bme18I GGWCC 1 cut(s) 542
BmeT110I CYCGRG 3 cut(s) 215, 422, 438
BmgT120I GGNCC 1 cut(s) 542
BmrFI CCNGG 3 cut(s) 76, 103, 377
BmrI ACTGGG 1 cut(s) 46
BmsI GCATC 1 cut(s) 550
BmuI ACTGGG 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 451
BplI GAGNNNNNCTC 2 cut(s) 432, 464
BpuEI CTTGAG 3 cut(s) 162, 163, 293
BsaI GGTCTC 1 cut(s) 358
BsaWI WCCGGW 1 cut(s) 65
BsaXI ACNNNNNCTCC 4 cut(s) 19, 49, 235, 265
Bse1I ACTGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 205
BseBI CCWGG 3 cut(s) 76, 103, 377
BseMI GCAATG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 282
BseNI ACTGG 1 cut(s) 52
BseRI GAGGAG 5 cut(s) 160, 163, 166, 256, 259
BseXI GCAGC 1 cut(s) 155
BseYI CCCAGC 1 cut(s) 38
BshFI GGCC 2 cut(s) 420, 490
BsiHKCI CYCGRG 3 cut(s) 215, 422, 438
BsiSI CCGG 1 cut(s) 66
BslFI GGGAC 1 cut(s) 481
BsmAI GTCTC 1 cut(s) 358
BsmFI GGGAC 1 cut(s) 481
BsnI GGCC 2 cut(s) 420, 490
Bso31I GGTCTC 1 cut(s) 358
BsoBI CYCGRG 3 cut(s) 215, 422, 438
Bsp143I GATC 3 cut(s) 395, 432, 595
BspACI CCGC 2 cut(s) 212, 350
BspANI GGCC 2 cut(s) 420, 490
BspCNI CTCAG 1 cut(s) 283
BspPI GGATC 3 cut(s) 390, 427, 590
BspTNI GGTCTC 1 cut(s) 358
BsrDI GCAATG 1 cut(s) 205
BsrI ACTGG 1 cut(s) 52
BssMI GATC 3 cut(s) 395, 432, 595
BssSI CACGAG 1 cut(s) 642
Bst2BI CACGAG 1 cut(s) 642
Bst2UI CCWGG 3 cut(s) 76, 103, 377
Bst4CI ACNGT 2 cut(s) 113, 413
Bst6I CTCTTC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 291
BstKTI GATC 3 cut(s) 398, 435, 598
BstMAI GTCTC 1 cut(s) 358
BstMBI GATC 3 cut(s) 395, 432, 595
BstMWI GCNNNNNNNGC 1 cut(s) 400
BstNI CCWGG 3 cut(s) 76, 103, 377
BstSCI CCNGG 3 cut(s) 74, 101, 375
BstV1I GCAGC 1 cut(s) 155
BstV2I GAAGAC 1 cut(s) 451
BsuRI GGCC 2 cut(s) 420, 490
BtsIMutI CAGTG 2 cut(s) 310, 418
CaiI CAGNNNCTG 1 cut(s) 165
Cfr13I GGNCC 1 cut(s) 542
CseI GACGC 1 cut(s) 466
CspCI CAANNNNNGTGG 2 cut(s) 345, 380
CviAII CATG 2 cut(s) 400, 557
CviJI RGCY 9 cut(s) 5, 42, 124, 176, 375, 380, 420, 490, 638
CviKI_1 RGCY 9 cut(s) 5, 42, 124, 176, 375, 380, 420, 490, 638
DdeI CTNAG 1 cut(s) 291
DpnI GATC 3 cut(s) 397, 434, 597
DpnII GATC 3 cut(s) 395, 432, 595
EaeI YGGCCR 1 cut(s) 488
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco147I AGGCCT 1 cut(s) 420
Eco31I GGTCTC 1 cut(s) 358
Eco47I GGWCC 1 cut(s) 542
Eco57I CTGAAG 1 cut(s) 381
Eco88I CYCGRG 3 cut(s) 215, 422, 438
EcoRII CCWGG 3 cut(s) 74, 101, 375
FaeI CATG 2 cut(s) 403, 560
FaiI YATR 8 cut(s) 230, 254, 401, 497, 503, 531, 558, 603
FaqI GGGAC 1 cut(s) 481
FatI CATG 2 cut(s) 399, 556
Fnu4HI GCNGC 1 cut(s) 169
Fsp4HI GCNGC 1 cut(s) 169
GluI GCNGC 1 cut(s) 169
GsaI CCCAGC 1 cut(s) 42
HaeIII GGCC 2 cut(s) 420, 490
HapII CCGG 1 cut(s) 66
HgaI GACGC 1 cut(s) 466
Hin1II CATG 2 cut(s) 403, 560
HinfI GANTC 5 cut(s) 182, 218, 256, 300, 447
HpaII CCGG 1 cut(s) 66
HphI GGTGA 2 cut(s) 55, 570
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 3 cut(s) 91, 187, 261
Hpy188III TCNNGA 2 cut(s) 179, 611
Hpy8I GTNNAC 1 cut(s) 27
HpyAV CCTTC 2 cut(s) 226, 410
HpyCH4III ACNGT 2 cut(s) 113, 413
HpyCH4V TGCA 3 cut(s) 171, 403, 563
HpyF10VI GCNNNNNNNGC 1 cut(s) 400
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 2 cut(s) 403, 560
Kzo9I GATC 3 cut(s) 395, 432, 595
LmnI GCTCC 1 cut(s) 391
Lsp1109I GCAGC 1 cut(s) 155
LweI GCATC 1 cut(s) 550
MalI GATC 3 cut(s) 397, 434, 597
MboI GATC 3 cut(s) 395, 432, 595
MboII GAAGA 5 cut(s) 10, 218, 456, 466, 626
MlsI TGGCCA 1 cut(s) 490
MluCI AATT 2 cut(s) 93, 236
MluNI TGGCCA 1 cut(s) 490
MlyI GAGTC 3 cut(s) 227, 265, 441
MmeI TCCRAC 2 cut(s) 69, 284
Mox20I TGGCCA 1 cut(s) 490
MscI TGGCCA 1 cut(s) 490
Msp20I TGGCCA 1 cut(s) 490
MspI CCGG 1 cut(s) 66
MspR9I CCNGG 3 cut(s) 76, 103, 377
MvaI CCWGG 3 cut(s) 76, 103, 377
MwoI GCNNNNNNNGC 1 cut(s) 400
NdeII GATC 3 cut(s) 395, 432, 595
NlaIII CATG 2 cut(s) 403, 560
PaeR7I CTCGAG 2 cut(s) 422, 438
PceI AGGCCT 1 cut(s) 420
PfeI GAWTC 2 cut(s) 182, 300
PfoI TCCNGGA 1 cut(s) 101
PkrI GCNGC 1 cut(s) 170
PleI GAGTC 3 cut(s) 226, 264, 441
PpsI GAGTC 3 cut(s) 226, 264, 441
Psp6I CCWGG 3 cut(s) 74, 101, 375
PspFI CCCAGC 1 cut(s) 38
PspGI CCWGG 3 cut(s) 74, 101, 375
PspPI GGNCC 1 cut(s) 542
PspXI VCTCGAGB 2 cut(s) 422, 438
PstNI CAGNNNCTG 1 cut(s) 165
SatI GCNGC 1 cut(s) 169
Sau3AI GATC 3 cut(s) 395, 432, 595
Sau96I GGNCC 1 cut(s) 542
SchI GAGTC 3 cut(s) 227, 265, 441
ScrFI CCNGG 3 cut(s) 76, 103, 377
SetI ASST 5 cut(s) 80, 158, 178, 334, 586
SfaNI GCATC 1 cut(s) 550
Sfr274I CTCGAG 2 cut(s) 422, 438
SinI GGWCC 1 cut(s) 542
SlaI CTCGAG 2 cut(s) 422, 438
SmlI CTYRAG 5 cut(s) 142, 177, 272, 422, 438
SmoI CTYRAG 5 cut(s) 142, 177, 272, 422, 438
Sse9I AATT 2 cut(s) 93, 236
SseBI AGGCCT 1 cut(s) 420
SsiI CCGC 2 cut(s) 212, 350
StuI AGGCCT 1 cut(s) 420
StyD4I CCNGG 3 cut(s) 74, 101, 375
TaaI ACNGT 2 cut(s) 113, 413
TaqI TCGA 2 cut(s) 423, 439
TasI AATT 2 cut(s) 93, 236
TfiI GAWTC 2 cut(s) 182, 300
TscAI CASTG 2 cut(s) 310, 418
TseI GCWGC 1 cut(s) 168
TspDTI ATGAA 2 cut(s) 245, 618
TspGWI ACGGA 1 cut(s) 588
TspRI CASTG 2 cut(s) 310, 418
VpaK11BI GGWCC 1 cut(s) 542
XapI RAATTY 1 cut(s) 93
XhoI CTCGAG 2 cut(s) 422, 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.