Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0025757.1

Orthogroup ID

OG0008362

Physical Location & Seq

Genomic Coordinates Reverse (-)

12833 .. 14336

Gene Structure 1504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0025757.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

atgtatgtttcaggggaagaaccgcctgagtcattgtttatgaaggaattgaggaggaggggtatgagtccgacttctttgcttgaggaagcagagaggactgagcgtggaatcaatgatgagaggggcaaaggagatagaggtttctcaaatagaaatgcggtctcaactgaagtggagaaaagcctggctaatcaaagggagcgatccatgcagttgaacagtgaaggcctcgaggggttgatccctcgaggaagactcttgctgacgcttggagggacattcttcttggcattttggccatttatggtcataagtgtagcactattctctgctctctatatctactttggaccaacatttatccatgatgcaaacaacagaatatcaccacctcaatacattgatccgtatgaacttctggaagatgataggatttctcaaatagcccctcgtgtaaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

154

Amino Acids

17.56

Weight (kDa)

5.32

Isoelectric Point (pI)

46.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008362)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G50020
fragaria_vesca	FvH4_2g03130 FvH4_2g03130 FvH4_2g03130 FvH4_2g03130
malus_domestica	MD05G1106900.v1.1 MD10G1111900.v1.1
prunus_persica	Prupe.8G151000_v2.0.a1 Prupe.8G151000_v2.0.a1 Prupe.8G151000_v2.0.a1
pyrus_communis	pycom05g10380 pycom10g09670
rosa_chinensis	RchiOBHm_Chr6g0248001
rosa_laevigata	RLG00000015164
rosa_multiflora	Rmu_sc0010633.1_g000009 Rmu_sc0025757.1_g000004
rosa_roxburghii	Rroxscaffold_7G00213510
rosa_rugosa	Rorug05G0530100
rosa_samantha	Rh6AG045000 Rh6BG040100 Rh6CG038500 Rh6DG035500
rosa_wichuraiana	Rw6G003910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AbsI	CCTCGAGG	2 cut(s)	233, 249
AciI	CCGC	2 cut(s)	23, 161
AclWI	GGATC	3 cut(s)	201, 238, 401
AcoI	YGGCCR	1 cut(s)	299
AcuI	CTGAAG	1 cut(s)	192
AgsI	TTSAA	1 cut(s)	220
AjnI	CCWGG	1 cut(s)	186
Alw26I	GTCTC	1 cut(s)	169
AlwI	GGATC	3 cut(s)	201, 238, 401
Ama87I	CYCGRG	2 cut(s)	233, 249
AoxI	GGCC	2 cut(s)	229, 299
AspS9I	GGNCC	1 cut(s)	353
AsuHPI	GGTGA	1 cut(s)	381
AvaI	CYCGRG	2 cut(s)	233, 249
AvaII	GGWCC	1 cut(s)	353
BalI	TGGCCA	1 cut(s)	301
BauI	CACGAG	1 cut(s)	453
BbsI	GAAGAC	1 cut(s)	262
BcgI	CGANNNNNNTGC	2 cut(s)	61, 95
BciT130I	CCWGG	1 cut(s)	188
BcoDI	GTCTC	1 cut(s)	169
Bme1390I	CCNGG	1 cut(s)	188
Bme18I	GGWCC	1 cut(s)	353
BmeT110I	CYCGRG	2 cut(s)	233, 249
BmgT120I	GGNCC	1 cut(s)	353
BmrFI	CCNGG	1 cut(s)	188
BmsI	GCATC	1 cut(s)	361
BpiI	GAAGAC	1 cut(s)	262
BplI	GAGNNNNNCTC	2 cut(s)	243, 275
BpuEI	CTTGAG	1 cut(s)	104
BsaI	GGTCTC	1 cut(s)	169
BsaXI	ACNNNNNCTCC	2 cut(s)	46, 76
BseBI	CCWGG	1 cut(s)	188
BseMII	CTCAG	2 cut(s)	18, 93
BseRI	GAGGAG	2 cut(s)	67, 70
BshFI	GGCC	2 cut(s)	231, 301
BsiHKCI	CYCGRG	2 cut(s)	233, 249
BslFI	GGGAC	1 cut(s)	292
BsmAI	GTCTC	1 cut(s)	169
BsmFI	GGGAC	1 cut(s)	292
BsnI	GGCC	2 cut(s)	231, 301
Bso31I	GGTCTC	1 cut(s)	169
BsoBI	CYCGRG	2 cut(s)	233, 249
Bsp143I	GATC	3 cut(s)	206, 243, 406
BspACI	CCGC	2 cut(s)	23, 161
BspANI	GGCC	2 cut(s)	231, 301
BspCNI	CTCAG	2 cut(s)	19, 94
BspPI	GGATC	3 cut(s)	201, 238, 401
BspTNI	GGTCTC	1 cut(s)	169
BssMI	GATC	3 cut(s)	206, 243, 406
BssSI	CACGAG	1 cut(s)	453
Bst2BI	CACGAG	1 cut(s)	453
Bst2UI	CCWGG	1 cut(s)	188
Bst4CI	ACNGT	1 cut(s)	224
BstDEI	CTNAG	2 cut(s)	27, 102
BstKTI	GATC	3 cut(s)	209, 246, 409
BstMAI	GTCTC	1 cut(s)	169
BstMBI	GATC	3 cut(s)	206, 243, 406
BstMWI	GCNNNNNNNGC	1 cut(s)	211
BstNI	CCWGG	1 cut(s)	188
BstSCI	CCNGG	1 cut(s)	186
BstV2I	GAAGAC	1 cut(s)	262
BsuRI	GGCC	2 cut(s)	231, 301
BtsIMutI	CAGTG	1 cut(s)	229
Cfr13I	GGNCC	1 cut(s)	353
CseI	GACGC	1 cut(s)	277
CspCI	CAANNNNNGTGG	2 cut(s)	156, 191
CviAII	CATG	2 cut(s)	211, 368
CviJI	RGCY	5 cut(s)	186, 191, 231, 301, 449
CviKI_1	RGCY	5 cut(s)	186, 191, 231, 301, 449
DdeI	CTNAG	2 cut(s)	27, 102
DpnI	GATC	3 cut(s)	208, 245, 408
DpnII	GATC	3 cut(s)	206, 243, 406
EaeI	YGGCCR	1 cut(s)	299
Eco147I	AGGCCT	1 cut(s)	231
Eco31I	GGTCTC	1 cut(s)	169
Eco47I	GGWCC	1 cut(s)	353
Eco57I	CTGAAG	1 cut(s)	192
Eco88I	CYCGRG	2 cut(s)	233, 249
EcoRII	CCWGG	1 cut(s)	186
FaeI	CATG	2 cut(s)	214, 371
FaiI	YATR	9 cut(s)	6, 41, 65, 212, 308, 314, 342, 369, 414
FaqI	GGGAC	1 cut(s)	292
FatI	CATG	2 cut(s)	210, 367
HaeIII	GGCC	2 cut(s)	231, 301
HgaI	GACGC	1 cut(s)	277
Hin1II	CATG	2 cut(s)	214, 371
HinfI	GANTC	4 cut(s)	29, 67, 111, 258
HphI	GGTGA	1 cut(s)	381
Hpy188I	TCNGA	1 cut(s)	72
Hpy188III	TCNNGA	1 cut(s)	422
HpyAV	CCTTC	2 cut(s)	37, 221
HpyCH4III	ACNGT	1 cut(s)	224
HpyCH4V	TGCA	2 cut(s)	214, 374
HpyF10VI	GCNNNNNNNGC	1 cut(s)	211
HpyF3I	CTNAG	2 cut(s)	27, 102
Hsp92II	CATG	2 cut(s)	214, 371
Kzo9I	GATC	3 cut(s)	206, 243, 406
LmnI	GCTCC	1 cut(s)	202
LpnPI	CCDG	4 cut(s)	39, 173, 200, 407
LweI	GCATC	1 cut(s)	361
MalI	GATC	3 cut(s)	208, 245, 408
MboI	GATC	3 cut(s)	206, 243, 406
MboII	GAAGA	4 cut(s)	29, 267, 277, 437
MlsI	TGGCCA	1 cut(s)	301
MluCI	AATT	1 cut(s)	47
MluNI	TGGCCA	1 cut(s)	301
MlyI	GAGTC	3 cut(s)	38, 76, 252
MmeI	TCCRAC	1 cut(s)	95
Mox20I	TGGCCA	1 cut(s)	301
MscI	TGGCCA	1 cut(s)	301
Msp20I	TGGCCA	1 cut(s)	301
MspR9I	CCNGG	1 cut(s)	188
MvaI	CCWGG	1 cut(s)	188
MwoI	GCNNNNNNNGC	1 cut(s)	211
NdeII	GATC	3 cut(s)	206, 243, 406
NlaIII	CATG	2 cut(s)	214, 371
PaeR7I	CTCGAG	2 cut(s)	233, 249
PceI	AGGCCT	1 cut(s)	231
PfeI	GAWTC	1 cut(s)	111
PleI	GAGTC	3 cut(s)	37, 75, 252
PpsI	GAGTC	3 cut(s)	37, 75, 252
Psp6I	CCWGG	1 cut(s)	186
PspGI	CCWGG	1 cut(s)	186
PspPI	GGNCC	1 cut(s)	353
PspXI	VCTCGAGB	2 cut(s)	233, 249
Sau3AI	GATC	3 cut(s)	206, 243, 406
Sau96I	GGNCC	1 cut(s)	353
SchI	GAGTC	3 cut(s)	38, 76, 252
ScrFI	CCNGG	1 cut(s)	188
SetI	ASST	2 cut(s)	145, 397
SfaNI	GCATC	1 cut(s)	361
Sfr274I	CTCGAG	2 cut(s)	233, 249
SinI	GGWCC	1 cut(s)	353
SlaI	CTCGAG	2 cut(s)	233, 249
SmlI	CTYRAG	3 cut(s)	83, 233, 249
SmoI	CTYRAG	3 cut(s)	83, 233, 249
Sse9I	AATT	1 cut(s)	47
SseBI	AGGCCT	1 cut(s)	231
SsiI	CCGC	2 cut(s)	23, 161
StuI	AGGCCT	1 cut(s)	231
StyD4I	CCNGG	1 cut(s)	186
TaaI	ACNGT	1 cut(s)	224
TaqI	TCGA	2 cut(s)	234, 250
TasI	AATT	1 cut(s)	47
TfiI	GAWTC	1 cut(s)	111
TscAI	CASTG	1 cut(s)	229
TspDTI	ATGAA	2 cut(s)	56, 429
TspGWI	ACGGA	1 cut(s)	399
TspRI	CASTG	1 cut(s)	229
VpaK11BI	GGWCC	1 cut(s)	353
XhoI	CTCGAG	2 cut(s)	233, 249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.