Rmu_sc0025757.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025757.1
Physical Location & Seq
Reverse (-)
12833 .. 14336
1504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025757.1_g000004.1.cds

Sequence Viewer

Length: 465 bp
atgtatgtttcaggggaagaaccgcctgagtcattgtttatgaaggaattgaggaggaggggtatgagtccgacttctttgcttgaggaagcagagaggactgagcgtggaatcaatgatgagaggggcaaaggagatagaggtttctcaaatagaaatgcggtctcaactgaagtggagaaaagcctggctaatcaaagggagcgatccatgcagttgaacagtgaaggcctcgaggggttgatccctcgaggaagactcttgctgacgcttggagggacattcttcttggcattttggccatttatggtcataagtgtagcactattctctgctctctatatctactttggaccaacatttatccatgatgcaaacaacagaatatcaccacctcaatacattgatccgtatgaacttctggaagatgataggatttctcaaatagcccctcgtgtaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

154

Amino Acids

17.56

Weight (kDa)

5.32

Isoelectric Point (pI)

46.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 2 cut(s) 233, 249
AciI CCGC 2 cut(s) 23, 161
AclWI GGATC 3 cut(s) 201, 238, 401
AcoI YGGCCR 1 cut(s) 299
AcuI CTGAAG 1 cut(s) 192
AgsI TTSAA 1 cut(s) 220
AjnI CCWGG 1 cut(s) 186
Alw26I GTCTC 1 cut(s) 169
AlwI GGATC 3 cut(s) 201, 238, 401
Ama87I CYCGRG 2 cut(s) 233, 249
AoxI GGCC 2 cut(s) 229, 299
AspS9I GGNCC 1 cut(s) 353
AsuHPI GGTGA 1 cut(s) 381
AvaI CYCGRG 2 cut(s) 233, 249
AvaII GGWCC 1 cut(s) 353
BalI TGGCCA 1 cut(s) 301
BauI CACGAG 1 cut(s) 453
BbsI GAAGAC 1 cut(s) 262
BcgI CGANNNNNNTGC 2 cut(s) 61, 95
BciT130I CCWGG 1 cut(s) 188
BcoDI GTCTC 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 188
Bme18I GGWCC 1 cut(s) 353
BmeT110I CYCGRG 2 cut(s) 233, 249
BmgT120I GGNCC 1 cut(s) 353
BmrFI CCNGG 1 cut(s) 188
BmsI GCATC 1 cut(s) 361
BpiI GAAGAC 1 cut(s) 262
BplI GAGNNNNNCTC 2 cut(s) 243, 275
BpuEI CTTGAG 1 cut(s) 104
BsaI GGTCTC 1 cut(s) 169
BsaXI ACNNNNNCTCC 2 cut(s) 46, 76
BseBI CCWGG 1 cut(s) 188
BseMII CTCAG 2 cut(s) 18, 93
BseRI GAGGAG 2 cut(s) 67, 70
BshFI GGCC 2 cut(s) 231, 301
BsiHKCI CYCGRG 2 cut(s) 233, 249
BslFI GGGAC 1 cut(s) 292
BsmAI GTCTC 1 cut(s) 169
BsmFI GGGAC 1 cut(s) 292
BsnI GGCC 2 cut(s) 231, 301
Bso31I GGTCTC 1 cut(s) 169
BsoBI CYCGRG 2 cut(s) 233, 249
Bsp143I GATC 3 cut(s) 206, 243, 406
BspACI CCGC 2 cut(s) 23, 161
BspANI GGCC 2 cut(s) 231, 301
BspCNI CTCAG 2 cut(s) 19, 94
BspPI GGATC 3 cut(s) 201, 238, 401
BspTNI GGTCTC 1 cut(s) 169
BssMI GATC 3 cut(s) 206, 243, 406
BssSI CACGAG 1 cut(s) 453
Bst2BI CACGAG 1 cut(s) 453
Bst2UI CCWGG 1 cut(s) 188
Bst4CI ACNGT 1 cut(s) 224
BstDEI CTNAG 2 cut(s) 27, 102
BstKTI GATC 3 cut(s) 209, 246, 409
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 3 cut(s) 206, 243, 406
BstMWI GCNNNNNNNGC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 186
BstV2I GAAGAC 1 cut(s) 262
BsuRI GGCC 2 cut(s) 231, 301
BtsIMutI CAGTG 1 cut(s) 229
Cfr13I GGNCC 1 cut(s) 353
CseI GACGC 1 cut(s) 277
CspCI CAANNNNNGTGG 2 cut(s) 156, 191
CviAII CATG 2 cut(s) 211, 368
CviJI RGCY 5 cut(s) 186, 191, 231, 301, 449
CviKI_1 RGCY 5 cut(s) 186, 191, 231, 301, 449
DdeI CTNAG 2 cut(s) 27, 102
DpnI GATC 3 cut(s) 208, 245, 408
DpnII GATC 3 cut(s) 206, 243, 406
EaeI YGGCCR 1 cut(s) 299
Eco147I AGGCCT 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 353
Eco57I CTGAAG 1 cut(s) 192
Eco88I CYCGRG 2 cut(s) 233, 249
EcoRII CCWGG 1 cut(s) 186
FaeI CATG 2 cut(s) 214, 371
FaiI YATR 9 cut(s) 6, 41, 65, 212, 308, 314, 342, 369, 414
FaqI GGGAC 1 cut(s) 292
FatI CATG 2 cut(s) 210, 367
HaeIII GGCC 2 cut(s) 231, 301
HgaI GACGC 1 cut(s) 277
Hin1II CATG 2 cut(s) 214, 371
HinfI GANTC 4 cut(s) 29, 67, 111, 258
HphI GGTGA 1 cut(s) 381
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 422
HpyAV CCTTC 2 cut(s) 37, 221
HpyCH4III ACNGT 1 cut(s) 224
HpyCH4V TGCA 2 cut(s) 214, 374
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpyF3I CTNAG 2 cut(s) 27, 102
Hsp92II CATG 2 cut(s) 214, 371
Kzo9I GATC 3 cut(s) 206, 243, 406
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 4 cut(s) 39, 173, 200, 407
LweI GCATC 1 cut(s) 361
MalI GATC 3 cut(s) 208, 245, 408
MboI GATC 3 cut(s) 206, 243, 406
MboII GAAGA 4 cut(s) 29, 267, 277, 437
MlsI TGGCCA 1 cut(s) 301
MluCI AATT 1 cut(s) 47
MluNI TGGCCA 1 cut(s) 301
MlyI GAGTC 3 cut(s) 38, 76, 252
MmeI TCCRAC 1 cut(s) 95
Mox20I TGGCCA 1 cut(s) 301
MscI TGGCCA 1 cut(s) 301
Msp20I TGGCCA 1 cut(s) 301
MspR9I CCNGG 1 cut(s) 188
MvaI CCWGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 211
NdeII GATC 3 cut(s) 206, 243, 406
NlaIII CATG 2 cut(s) 214, 371
PaeR7I CTCGAG 2 cut(s) 233, 249
PceI AGGCCT 1 cut(s) 231
PfeI GAWTC 1 cut(s) 111
PleI GAGTC 3 cut(s) 37, 75, 252
PpsI GAGTC 3 cut(s) 37, 75, 252
Psp6I CCWGG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 186
PspPI GGNCC 1 cut(s) 353
PspXI VCTCGAGB 2 cut(s) 233, 249
Sau3AI GATC 3 cut(s) 206, 243, 406
Sau96I GGNCC 1 cut(s) 353
SchI GAGTC 3 cut(s) 38, 76, 252
ScrFI CCNGG 1 cut(s) 188
SetI ASST 2 cut(s) 145, 397
SfaNI GCATC 1 cut(s) 361
Sfr274I CTCGAG 2 cut(s) 233, 249
SinI GGWCC 1 cut(s) 353
SlaI CTCGAG 2 cut(s) 233, 249
SmlI CTYRAG 3 cut(s) 83, 233, 249
SmoI CTYRAG 3 cut(s) 83, 233, 249
Sse9I AATT 1 cut(s) 47
SseBI AGGCCT 1 cut(s) 231
SsiI CCGC 2 cut(s) 23, 161
StuI AGGCCT 1 cut(s) 231
StyD4I CCNGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 224
TaqI TCGA 2 cut(s) 234, 250
TasI AATT 1 cut(s) 47
TfiI GAWTC 1 cut(s) 111
TscAI CASTG 1 cut(s) 229
TspDTI ATGAA 2 cut(s) 56, 429
TspGWI ACGGA 1 cut(s) 399
TspRI CASTG 1 cut(s) 229
VpaK11BI GGWCC 1 cut(s) 353
XhoI CTCGAG 2 cut(s) 233, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.