Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011733.1

Orthogroup ID

OG0009539

Physical Location & Seq

Genomic Coordinates Reverse (-)

3450 .. 5032

Gene Structure 1583 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011733.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 909 bp

atggaaagaagggcatcttctccgatggctgctattcttgtttacattgcagttttcatggctgctgcttattgttcttcatctgtatcagctgcaccatcaacttctttcgaagacaatttcaacataatgtggtccgaggaccatttcaaaacctctgcagatggggagatctggtacctctcgctcgacaataatacaggttgcgggtttcaaaccaaacagatgtacagatttggttggtacagcatgaagctcaagctggttggtggcgactctgctggtgtagtgacagcttactatatgtgtactgaaaatggagcagggccaaccagagatgagctagattttgagttcttggggaataggagtggccagccttatctgattcagacaaatgtttacaagaatggaactgggaaccgtgagatgaggcacagcctttggtttgaccccactgaggattatcatacctattcaattctttggaacaatcatcagattgtattttttgttgacaaagttcccataagggtgtttaagaacaatggtgaagcaaacgacttcttccccaacgagaaacccatgtatttgttctctagcatatggaatgccgatgaatgggcgacgagaggtggacttgagaagacagactggaaaaaatcaccatttgtgtcttcctacaaggacttcagtgttgatgcatgccagtgggaagatccataccctaaatgtgtgtccacaacaacagagaactggtgggatcagtatgatgcttggcacctttcagattctcagaaaatggactatgcttggatacaaagaaaccttgttgtttatgattattgcaaggacactgagaggttcccaacattgccagtggagtgtccattgagtccatgggaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_hydro_16 XET_C

Protein Analysis

302

Amino Acids

35.07

Weight (kDa)

4.8

Isoelectric Point (pI)

41.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009539)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11545
fragaria_vesca	FvH4_3g02630
malus_domestica	MD00G1180100.v1.1 MD10G1315100.v1.1
prunus_persica	Prupe.4G025600_v2.0.a1 Prupe.4G025600_v2.0.a1 Prupe.4G025600_v2.0.a1 Prupe.4G025600_v2.0.a1
pyrus_communis	pycom05g31080 pycom10g26730
rosa_chinensis	RchiOBHm_Chr5g0003921
rosa_laevigata	RLG00000031188
rosa_multiflora	Rmu_sc0011733.1_g000002 Rmu_sc0019391.1_g000004
rosa_roxburghii	Rroxscaffold_1G00072050 Rroxscaffold_5G00358140
rosa_rugosa	Rorug04G0407900
rosa_samantha	Rh5AG035500 Rh5BG034100 Rh5CG038000 Rh5DG034200
rosa_wichuraiana	Rw5G003250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	177
AccB1I	GGYRCC	2 cut(s)	177, 780
AciI	CCGC	1 cut(s)	207
AclWI	GGATC	2 cut(s)	713, 771
AcoI	YGGCCR	1 cut(s)	373
AcuI	CTGAAG	1 cut(s)	676
AfaI	GTAC	4 cut(s)	179, 230, 245, 310
AfiI	CCNNNNNNNGG	2 cut(s)	460, 621
AgsI	TTSAA	4 cut(s)	124, 151, 215, 480
AluBI	AGCT	5 cut(s)	92, 256, 262, 296, 343
AluI	AGCT	5 cut(s)	92, 256, 262, 296, 343
AlwI	GGATC	2 cut(s)	713, 771
AoxI	GGCC	2 cut(s)	326, 373
ApeKI	GCWGC	4 cut(s)	29, 62, 65, 92
Asp718I	GGTACC	1 cut(s)	177
AspS9I	GGNCC	3 cut(s)	135, 142, 326
AsuHPI	GGTGA	2 cut(s)	563, 657
AsuII	TTCGAA	1 cut(s)	111
AvaII	GGWCC	2 cut(s)	135, 142
BalI	TGGCCA	1 cut(s)	375
BanI	GGYRCC	2 cut(s)	177, 780
BbsI	GAAGAC	3 cut(s)	120, 653, 669
BbvI	GCAGC	4 cut(s)	16, 49, 52, 79
BccI	CCATC	3 cut(s)	19, 106, 158
BciVI	GTATCC	1 cut(s)	810
BfaI	CTAG	2 cut(s)	344, 600
BfmI	CTRYAG	1 cut(s)	159
BfuI	GTATCC	1 cut(s)	810
BglII	AGATCT	1 cut(s)	171
BisI	GCNGC	4 cut(s)	30, 63, 66, 93
BlsI	GCNGC	4 cut(s)	31, 64, 67, 94
Bme18I	GGWCC	2 cut(s)	135, 142
BmgT120I	GGNCC	3 cut(s)	135, 142, 326
BmiI	GGNNCC	4 cut(s)	179, 422, 782, 866
BmrI	ACTGGG	1 cut(s)	426
BmsI	GCATC	3 cut(s)	23, 691, 763
BmuI	ACTGGG	1 cut(s)	426
BpiI	GAAGAC	3 cut(s)	120, 653, 669
Bpu14I	TTCGAA	1 cut(s)	111
BpuEI	CTTGAG	2 cut(s)	242, 662
BsaJI	CCNNGG	2 cut(s)	138, 899
BsaXI	ACNNNNNCTCC	2 cut(s)	161, 191
Bsc4I	CCNNNNNNNGG	2 cut(s)	460, 621
Bse1I	ACTGG	5 cut(s)	421, 659, 709, 761, 878
Bse3DI	GCAATG	2 cut(s)	45, 872
BseDI	CCNNGG	2 cut(s)	138, 899
BseLI	CCNNNNNNNGG	2 cut(s)	460, 621
BseMI	GCAATG	2 cut(s)	45, 872
BseMII	CTCAG	3 cut(s)	450, 809, 849
BseNI	ACTGG	5 cut(s)	421, 659, 709, 761, 878
BseXI	GCAGC	4 cut(s)	16, 49, 52, 79
BsgI	GTGCAG	1 cut(s)	78
BshFI	GGCC	2 cut(s)	328, 375
BshNI	GGYRCC	2 cut(s)	177, 780
BslI	CCNNNNNNNGG	2 cut(s)	460, 621
BsmI	GAATGC	1 cut(s)	616
BsnI	GGCC	2 cut(s)	328, 375
Bsp119I	TTCGAA	1 cut(s)	111
Bsp1407I	TGTACA	1 cut(s)	228
Bsp143I	GATC	3 cut(s)	171, 718, 763
Bsp19I	CCATGG	1 cut(s)	899
BspACI	CCGC	1 cut(s)	207
BspANI	GGCC	2 cut(s)	328, 375
BspCNI	CTCAG	3 cut(s)	451, 808, 850
BspLI	GGNNCC	4 cut(s)	179, 422, 782, 866
BspMAI	CTGCAG	1 cut(s)	163
BspPI	GGATC	2 cut(s)	713, 771
BspT104I	TTCGAA	1 cut(s)	111
BspT107I	GGYRCC	2 cut(s)	177, 780
BsrDI	GCAATG	2 cut(s)	45, 872
BsrGI	TGTACA	1 cut(s)	228
BsrI	ACTGG	5 cut(s)	421, 659, 709, 761, 878
BssECI	CCNNGG	2 cut(s)	138, 899
BssMI	GATC	3 cut(s)	171, 718, 763
BssT1I	CCWWGG	1 cut(s)	899
Bst4CI	ACNGT	1 cut(s)	425
BstAUI	TGTACA	1 cut(s)	228
BstBI	TTCGAA	1 cut(s)	111
BstC8I	GCNNGC	2 cut(s)	377, 706
BstDEI	CTNAG	3 cut(s)	459, 795, 858
BstDSI	CCRYGG	1 cut(s)	899
BstKTI	GATC	3 cut(s)	174, 721, 766
BstMBI	GATC	3 cut(s)	171, 718, 763
BstNSI	RCATGY	1 cut(s)	708
BstSFI	CTRYAG	1 cut(s)	159
BstV1I	GCAGC	4 cut(s)	16, 49, 52, 79
BstV2I	GAAGAC	3 cut(s)	120, 653, 669
BstX2I	RGATCY	2 cut(s)	171, 718
BstYI	RGATCY	2 cut(s)	171, 718
BsuI	GTATCC	1 cut(s)	810
BsuRI	GGCC	2 cut(s)	328, 375
BtgI	CCRYGG	1 cut(s)	899
BtsIMutI	CAGTG	5 cut(s)	456, 700, 716, 855, 885
Cac8I	GCNNGC	2 cut(s)	377, 706
Cfr13I	GGNCC	3 cut(s)	135, 142, 326
Csp6I	GTAC	4 cut(s)	178, 229, 244, 309
CviAII	CATG	5 cut(s)	58, 250, 586, 705, 900
CviQI	GTAC	4 cut(s)	178, 229, 244, 309
DdeI	CTNAG	3 cut(s)	459, 795, 858
DpnI	GATC	3 cut(s)	173, 720, 765
DpnII	GATC	3 cut(s)	171, 718, 763
EaeI	YGGCCR	1 cut(s)	373
Eco130I	CCWWGG	1 cut(s)	899
Eco47I	GGWCC	2 cut(s)	135, 142
Eco57I	CTGAAG	1 cut(s)	676
EcoT14I	CCWWGG	1 cut(s)	899
EcoT22I	ATGCAT	1 cut(s)	706
ErhI	CCWWGG	1 cut(s)	899
FaeI	CATG	5 cut(s)	61, 253, 589, 708, 903
FalI	AAGNNNNNCTT	1 cut(s)	33
FatI	CATG	5 cut(s)	57, 249, 585, 704, 899
FauI	CCCGC	1 cut(s)	200
FauNDI	CATATG	1 cut(s)	605
Fnu4HI	GCNGC	4 cut(s)	30, 63, 66, 93
Fsp4HI	GCNGC	4 cut(s)	30, 63, 66, 93
FspBI	CTAG	2 cut(s)	344, 600
GluI	GCNGC	4 cut(s)	30, 63, 66, 93
HaeIII	GGCC	2 cut(s)	328, 375
Hin1II	CATG	5 cut(s)	61, 253, 589, 708, 903
HincII	GTYRAC	1 cut(s)	517
HindII	GTYRAC	1 cut(s)	517
HinfI	GANTC	4 cut(s)	275, 388, 791, 895
HphI	GGTGA	2 cut(s)	563, 657
Hpy166II	GTNNAC	6 cut(s)	43, 309, 403, 517, 638, 741
Hpy188I	TCNGA	7 cut(s)	24, 139, 387, 393, 501, 790, 798
Hpy8I	GTNNAC	6 cut(s)	43, 309, 403, 517, 638, 741
Hpy99I	CGWCG	1 cut(s)	631
HpyAV	CCTTC	1 cut(s)	3
HpyCH4III	ACNGT	1 cut(s)	425
HpyCH4V	TGCA	5 cut(s)	50, 95, 161, 704, 849
HpyF3I	CTNAG	3 cut(s)	459, 795, 858
Hsp92II	CATG	5 cut(s)	61, 253, 589, 708, 903
KpnI	GGTACC	1 cut(s)	181
Kzo9I	GATC	3 cut(s)	171, 718, 763
LmnI	GCTCC	1 cut(s)	320
Lsp1109I	GCAGC	4 cut(s)	16, 49, 52, 79
LweI	GCATC	3 cut(s)	23, 691, 763
MaeI	CTAG	2 cut(s)	344, 600
MaeIII	GTNAC	1 cut(s)	289
MalI	GATC	3 cut(s)	173, 720, 765
MboI	GATC	3 cut(s)	171, 718, 763
MboII	GAAGA	7 cut(s)	9, 69, 125, 559, 658, 669, 728
MflI	RGATCY	2 cut(s)	171, 718
MlsI	TGGCCA	1 cut(s)	375
MluCI	AATT	2 cut(s)	118, 480
MluNI	TGGCCA	1 cut(s)	375
MlyI	GAGTC	2 cut(s)	269, 904
MnlI	CCTC	7 cut(s)	133, 166, 191, 426, 454, 626, 855
Mox20I	TGGCCA	1 cut(s)	375
Mph1103I	ATGCAT	1 cut(s)	706
MscI	TGGCCA	1 cut(s)	375
MseI	TTAA	1 cut(s)	540
MslI	CAYNNNNRTG	3 cut(s)	533, 709, 904
Msp20I	TGGCCA	1 cut(s)	375
MspA1I	CMGCKG	1 cut(s)	92
Mva1269I	GAATGC	1 cut(s)	616
NcoI	CCATGG	1 cut(s)	899
NdeI	CATATG	1 cut(s)	605
NdeII	GATC	3 cut(s)	171, 718, 763
NlaIII	CATG	5 cut(s)	61, 253, 589, 708, 903
NlaIV	GGNNCC	4 cut(s)	179, 422, 782, 866
NmuCI	GTSAC	1 cut(s)	289
NsiI	ATGCAT	1 cut(s)	706
NspI	RCATGY	1 cut(s)	708
NspV	TTCGAA	1 cut(s)	111
PaeI	GCATGC	1 cut(s)	708
PctI	GAATGC	1 cut(s)	616
PfeI	GAWTC	2 cut(s)	388, 791
PkrI	GCNGC	4 cut(s)	31, 64, 67, 94
PleI	GAGTC	2 cut(s)	269, 903
PpsI	GAGTC	2 cut(s)	269, 903
PspN4I	GGNNCC	4 cut(s)	179, 422, 782, 866
PspPI	GGNCC	3 cut(s)	135, 142, 326
PstI	CTGCAG	1 cut(s)	163
PsuI	RGATCY	2 cut(s)	171, 718
PvuII	CAGCTG	1 cut(s)	92
RsaI	GTAC	4 cut(s)	179, 230, 245, 310
RsaNI	GTAC	4 cut(s)	178, 229, 244, 309
RseI	CAYNNNNRTG	3 cut(s)	533, 709, 904
SaqAI	TTAA	1 cut(s)	540
SatI	GCNGC	4 cut(s)	30, 63, 66, 93
Sau3AI	GATC	3 cut(s)	171, 718, 763
Sau96I	GGNCC	3 cut(s)	135, 142, 326
SchI	GAGTC	2 cut(s)	269, 904
SfaNI	GCATC	3 cut(s)	23, 691, 763
SfcI	CTRYAG	1 cut(s)	159
SfuI	TTCGAA	1 cut(s)	111
SinI	GGWCC	2 cut(s)	135, 142
SmiMI	CAYNNNNRTG	3 cut(s)	533, 709, 904
SmlI	CTYRAG	2 cut(s)	257, 641
SmoI	CTYRAG	2 cut(s)	257, 641
SphI	GCATGC	1 cut(s)	708
Sse9I	AATT	2 cut(s)	118, 480
SsiI	CCGC	1 cut(s)	207
SspMI	CTAG	2 cut(s)	344, 600
StyI	CCWWGG	1 cut(s)	899
TaaI	ACNGT	1 cut(s)	425
TaqI	TCGA	2 cut(s)	111, 189
TasI	AATT	2 cut(s)	118, 480
TatI	WGTACW	2 cut(s)	228, 308
TfiI	GAWTC	2 cut(s)	388, 791
Tru1I	TTAA	1 cut(s)	540
Tru9I	TTAA	1 cut(s)	540
TscAI	CASTG	5 cut(s)	463, 700, 716, 862, 885
TseFI	GTSAC	1 cut(s)	289
TseI	GCWGC	4 cut(s)	29, 62, 65, 92
Tsp45I	GTSAC	1 cut(s)	289
TspDTI	ATGAA	4 cut(s)	46, 69, 266, 633
TspRI	CASTG	5 cut(s)	463, 700, 716, 862, 885
VpaK11BI	GGWCC	2 cut(s)	135, 142
XceI	RCATGY	1 cut(s)	708
XcmI	CCANNNNNNNNNTGG	1 cut(s)	897
XspI	CTAG	2 cut(s)	344, 600
Zsp2I	ATGCAT	1 cut(s)	706

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.