Rh5BG034100

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0009539
Physical Location & Seq
Forward (+)
2385095 .. 2385418
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG034100.1

Sequence Viewer

Length: 324 bp
ATGTATTTGTTCTCGAGCATATGGAATGCCGATGAATGGGCGACGAGAGGTGGACTTGAGAAGACAGACTGGAAAAAATCACCATTTGTGTCTTCCTACAAGGACTTCAGTGTTGATGCATGCCAGTGGGAAGATCCATACCCTAAATGTGTGTCCACAACAACAGAGAACTGGTGGGATCAGTATGATGCTTGGCACCTTTCAGATTCTCAGAAAATGGACTATGCTTGGATACAAAGAAACATTGTTGTTTATGATTATTGCAAGGACACTGAGAGGTTCCCAACATTGCCAGTGGAGTGTCCATTGAGTCCATGGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_16 XET_C

Protein Analysis

107

Amino Acids

12.86

Weight (kDa)

4.48

Isoelectric Point (pI)

58.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
XET_C PF06955 54 - 101 2.3e-16 Xyloglucan endo-transglycosylase (XET) C-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 195
AclWI GGATC 2 cut(s) 128, 186
AcuI CTGAAG 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 36
AlwI GGATC 2 cut(s) 128, 186
Ama87I CYCGRG 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 72
AvaI CYCGRG 1 cut(s) 13
BanI GGYRCC 1 cut(s) 195
BbsI GAAGAC 2 cut(s) 68, 84
BciVI GTATCC 1 cut(s) 225
BfuI GTATCC 1 cut(s) 225
BmeT110I CYCGRG 1 cut(s) 13
BmiI GGNNCC 2 cut(s) 197, 281
BmsI GCATC 2 cut(s) 106, 178
BpiI GAAGAC 2 cut(s) 68, 84
BpuEI CTTGAG 1 cut(s) 77
BsaJI CCNNGG 1 cut(s) 314
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse1I ACTGG 4 cut(s) 74, 124, 176, 293
Bse3DI GCAATG 1 cut(s) 287
BseDI CCNNGG 1 cut(s) 314
BseLI CCNNNNNNNGG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 287
BseMII CTCAG 2 cut(s) 224, 264
BseNI ACTGG 4 cut(s) 74, 124, 176, 293
BshNI GGYRCC 1 cut(s) 195
BsiHKCI CYCGRG 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 36
BsmI GAATGC 1 cut(s) 31
BsoBI CYCGRG 1 cut(s) 13
Bsp143I GATC 2 cut(s) 133, 178
Bsp19I CCATGG 1 cut(s) 314
BspCNI CTCAG 2 cut(s) 223, 265
BspLI GGNNCC 2 cut(s) 197, 281
BspPI GGATC 2 cut(s) 128, 186
BspT107I GGYRCC 1 cut(s) 195
BsrDI GCAATG 1 cut(s) 287
BsrI ACTGG 4 cut(s) 74, 124, 176, 293
BssECI CCNNGG 1 cut(s) 314
BssMI GATC 2 cut(s) 133, 178
BssT1I CCWWGG 1 cut(s) 314
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 2 cut(s) 210, 273
BstDSI CCRYGG 1 cut(s) 314
BstKTI GATC 2 cut(s) 136, 181
BstMBI GATC 2 cut(s) 133, 178
BstNSI RCATGY 1 cut(s) 123
BstV2I GAAGAC 2 cut(s) 68, 84
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BsuI GTATCC 1 cut(s) 225
BtgI CCRYGG 1 cut(s) 314
BtsIMutI CAGTG 4 cut(s) 115, 131, 270, 300
Cac8I GCNNGC 1 cut(s) 121
CviAII CATG 2 cut(s) 120, 315
DdeI CTNAG 2 cut(s) 210, 273
DpnI GATC 2 cut(s) 135, 180
DpnII GATC 2 cut(s) 133, 178
Eco130I CCWWGG 1 cut(s) 314
Eco57I CTGAAG 1 cut(s) 91
Eco88I CYCGRG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 314
EcoT22I ATGCAT 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 314
FaeI CATG 2 cut(s) 123, 318
FaiI YATR 8 cut(s) 20, 22, 121, 139, 186, 225, 255, 316
FatI CATG 2 cut(s) 119, 314
FauNDI CATATG 1 cut(s) 20
Hin1II CATG 2 cut(s) 123, 318
HinfI GANTC 2 cut(s) 206, 310
HphI GGTGA 1 cut(s) 72
Hpy166II GTNNAC 2 cut(s) 53, 156
Hpy188I TCNGA 2 cut(s) 205, 213
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 2 cut(s) 53, 156
Hpy99I CGWCG 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 119, 264
HpyF3I CTNAG 2 cut(s) 210, 273
Hsp92II CATG 2 cut(s) 123, 318
Kzo9I GATC 2 cut(s) 133, 178
LpnPI CCDG 4 cut(s) 55, 137, 157, 306
LweI GCATC 2 cut(s) 106, 178
MalI GATC 2 cut(s) 135, 180
MboI GATC 2 cut(s) 133, 178
MboII GAAGA 3 cut(s) 73, 84, 143
MflI RGATCY 1 cut(s) 133
MlyI GAGTC 1 cut(s) 319
MnlI CCTC 2 cut(s) 41, 270
Mph1103I ATGCAT 1 cut(s) 121
MslI CAYNNNNRTG 2 cut(s) 124, 319
Mva1269I GAATGC 1 cut(s) 31
NcoI CCATGG 1 cut(s) 314
NdeI CATATG 1 cut(s) 20
NdeII GATC 2 cut(s) 133, 178
NlaIII CATG 2 cut(s) 123, 318
NlaIV GGNNCC 2 cut(s) 197, 281
NsiI ATGCAT 1 cut(s) 121
NspI RCATGY 1 cut(s) 123
PaeI GCATGC 1 cut(s) 123
PaeR7I CTCGAG 1 cut(s) 13
PctI GAATGC 1 cut(s) 31
PfeI GAWTC 1 cut(s) 206
PleI GAGTC 1 cut(s) 318
PpsI GAGTC 1 cut(s) 318
PspN4I GGNNCC 2 cut(s) 197, 281
PsuI RGATCY 1 cut(s) 133
RseI CAYNNNNRTG 2 cut(s) 124, 319
Sau3AI GATC 2 cut(s) 133, 178
SchI GAGTC 1 cut(s) 319
SetI ASST 3 cut(s) 52, 201, 281
SfaNI GCATC 2 cut(s) 106, 178
Sfr274I CTCGAG 1 cut(s) 13
SlaI CTCGAG 1 cut(s) 13
SmiMI CAYNNNNRTG 2 cut(s) 124, 319
SmlI CTYRAG 2 cut(s) 13, 56
SmoI CTYRAG 2 cut(s) 13, 56
SphI GCATGC 1 cut(s) 123
StyI CCWWGG 1 cut(s) 314
TaqI TCGA 1 cut(s) 14
TfiI GAWTC 1 cut(s) 206
TscAI CASTG 4 cut(s) 115, 131, 277, 300
TspDTI ATGAA 1 cut(s) 48
TspRI CASTG 4 cut(s) 115, 131, 277, 300
XceI RCATGY 1 cut(s) 123
XcmI CCANNNNNNNNNTGG 1 cut(s) 312
XhoI CTCGAG 1 cut(s) 13
Zsp2I ATGCAT 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.