Rmu_sc0012054.1_g000001

N-acetyl-gamma-glutamyl-phosphate reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012054.1
Physical Location & Seq
Reverse (-)
1 .. 454
454 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012054.1_g000001.1.cds

Sequence Viewer

Length: 186 bp
atgagctctgcaactctcagcgccaattttctccaaactgggtgccaatggaaggatggagtgaagaatgtagagagaaatgctgggaaggtgtttgtgaaatgttctgtgaattcaaaaacccagaaagcagaaaaggaagttcgccttggtgttcttggagccagtggctacactggttctgag

Protein Analysis

62

Amino Acids

6.6

Weight (kDa)

9.39

Isoelectric Point (pI)

15.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 42
AcsI RAATTY 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 117
AjuI GAANNNNNNNTTGG 2 cut(s) 132, 164
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Alw21I GWGCWC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 112
AspLEI GCGC 1 cut(s) 23
BanI GGYRCC 1 cut(s) 42
BanII GRGCYC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 50
BfoI RGCGCY 1 cut(s) 24
BmiI GGNNCC 2 cut(s) 44, 163
BmrI ACTGGG 1 cut(s) 48
BmuI ACTGGG 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse1I ACTGG 3 cut(s) 43, 165, 181
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 2 cut(s) 31, 174
BseNI ACTGG 3 cut(s) 43, 165, 181
BseYI CCCAGC 1 cut(s) 83
BshNI GGYRCC 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 8
BspCNI CTCAG 2 cut(s) 30, 175
BspLI GGNNCC 2 cut(s) 44, 163
BspT107I GGYRCC 1 cut(s) 42
BsrI ACTGG 3 cut(s) 43, 165, 181
BssECI CCNNGG 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 148
BstDEI CTNAG 2 cut(s) 17, 183
BstF5I GGATG 1 cut(s) 61
BstH2I RGCGCY 1 cut(s) 24
BstHHI GCGC 1 cut(s) 23
BtsCI GGATG 1 cut(s) 61
BtsIMutI CAGTG 2 cut(s) 172, 174
CfoI GCGC 1 cut(s) 23
CviJI RGCY 3 cut(s) 6, 164, 171
CviKI_1 RGCY 3 cut(s) 6, 164, 171
DdeI CTNAG 2 cut(s) 17, 183
Ecl136II GAGCTC 1 cut(s) 6
Eco130I CCWWGG 1 cut(s) 148
Eco24I GRGCYC 1 cut(s) 8
Eco53kI GAGCTC 1 cut(s) 6
EcoICRI GAGCTC 1 cut(s) 6
EcoRI GAATTC 1 cut(s) 112
EcoT14I CCWWGG 1 cut(s) 148
EcoT38I GRGCYC 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 148
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FokI GGATG 1 cut(s) 68
FriOI GRGCYC 1 cut(s) 8
GlaI GCGC 1 cut(s) 22
GsaI CCCAGC 1 cut(s) 87
HaeII RGCGCY 1 cut(s) 24
HhaI GCGC 1 cut(s) 23
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 184
HpyAV CCTTC 2 cut(s) 46, 82
HpyCH4V TGCA 1 cut(s) 11
HpyF3I CTNAG 2 cut(s) 17, 183
HspAI GCGC 1 cut(s) 21
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 5 cut(s) 24, 69, 137, 162, 178
MboII GAAGA 1 cut(s) 76
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 25, 112
NlaIV GGNNCC 2 cut(s) 44, 163
Psp124BI GAGCTC 1 cut(s) 8
PspFI CCCAGC 1 cut(s) 83
PspN4I GGNNCC 2 cut(s) 44, 163
SacI GAGCTC 1 cut(s) 8
SduI GDGCHC 1 cut(s) 8
SetI ASST 2 cut(s) 8, 93
SgeI CNNG 6 cut(s) 51, 96, 136, 161, 170, 177
Sse9I AATT 2 cut(s) 25, 112
SstI GAGCTC 1 cut(s) 8
StyI CCWWGG 1 cut(s) 148
TasI AATT 2 cut(s) 25, 112
TscAI CASTG 2 cut(s) 172, 181
TspRI CASTG 2 cut(s) 172, 181
XapI RAATTY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.