Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012066.1

Orthogroup ID

OG0008528

Physical Location & Seq

Genomic Coordinates Reverse (-)

23898 .. 25681

Gene Structure 1784 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012066.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 759 bp

atgaaccgccgcgtttggtttgaaggaagagcagagagaaaggaaatgaaggtaggtccaaaggtagtgcttctgttgagagacccagagggcttcggccaagccatctccgacgcgttccaccctaacccaactgcttccgtcacagaggaaagcttcgagctttcgctggagcgctatgggatccgaaattgcaaagcttctggaaaagttcgtcactttcttgatcagcacggtcaatatgaggtgtcagtgttgcttatggaatattatgaatcaccgatactagcatgtgcttttaatgaagttctggctgaactagcaggacaaaaatcatcctcaatgcccaccattgttgccccctttttcgttgcatcatccaagcttaaatgggacagtaaatctgcaacaaagtttgacagcaaaggttcactttatggtatacagataggtccagaaacagacataagcaaggccatcattgccagaacgcagaaagcaccaccgtcattacagattcttcatgaacctctagcctgccttcttcagttggtccgtgtcctgaatttgccaactcttgttcttatagggcaaaggggtcagcgaatttctgataaagaagagcttgagacactttatgaaattggggaacttttggcaaacacttgtaaggtaaacttctcaagaggcaaaatcacatggaagccaacaaaaaaatcgaaggatgaacaggagccatggcgtgcattgtatggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

252

Amino Acids

28.31

Weight (kDa)

8.78

Isoelectric Point (pI)

34.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008528)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07640
fragaria_vesca	FvH4_6g40230
malus_domestica	MD17G1121200.v1.1 MD17G1122600.v1.1
prunus_persica	Prupe.3G192700_v2.0.a1 Prupe.3G192700_v2.0.a1 Prupe.3G192700_v2.0.a1
pyrus_communis	pycom17g11160 pycom17g11210 pycom17g11290 pycom17g11320 pycom17g11390 pycom17g11430
rosa_chinensis	RchiOBHm_Chr2g0155251
rosa_laevigata	RLG00000020830
rosa_multiflora	Rmu_sc0012066.1_g000007
rosa_roxburghii	Rroxscaffold_2G00093830
rosa_rugosa	Rorug02G0446300
rosa_samantha	Rh2AG512800 Rh2BG523400 Rh2CG497800 Rh2DG533100
rosa_wichuraiana	Rw2G042130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	442
AccII	CGCG	2 cut(s)	12, 116
AciI	CCGC	2 cut(s)	7, 10
AclWI	GGATC	2 cut(s)	178, 191
AcoI	YGGCCR	1 cut(s)	97
AcsI	RAATTY	2 cut(s)	565, 606
AcuI	CTGAAG	1 cut(s)	530
AfeI	AGCGCT	1 cut(s)	176
AflIII	ACRYGT	1 cut(s)	114
AgsI	TTSAA	1 cut(s)	23
AluBI	AGCT	5 cut(s)	156, 163, 200, 385, 625
AluI	AGCT	5 cut(s)	156, 163, 200, 385, 625
Alw26I	GTCTC	2 cut(s)	75, 623
AlwI	GGATC	2 cut(s)	178, 191
Aor51HI	AGCGCT	1 cut(s)	176
AoxI	GGCC	2 cut(s)	97, 474
ApoI	RAATTY	2 cut(s)	565, 606
AspLEI	GCGC	1 cut(s)	177
AspS9I	GGNCC	3 cut(s)	56, 452, 553
AsuHPI	GGTGA	1 cut(s)	270
AvaII	GGWCC	3 cut(s)	56, 452, 553
BamHI	GGATCC	1 cut(s)	183
BccI	CCATC	2 cut(s)	113, 485
BclI	TGATCA	1 cut(s)	226
BcoDI	GTCTC	2 cut(s)	75, 623
BfaI	CTAG	3 cut(s)	287, 320, 533
BfoI	RGCGCY	1 cut(s)	178
BisI	GCNGC	1 cut(s)	10
BlsI	GCNGC	1 cut(s)	11
Bme18I	GGWCC	3 cut(s)	56, 452, 553
BmgT120I	GGNCC	3 cut(s)	56, 452, 553
BmiI	GGNNCC	2 cut(s)	185, 735
BmsI	GCATC	1 cut(s)	383
BpmI	CTGGAG	1 cut(s)	191
BpuEI	CTTGAG	2 cut(s)	647, 667
BsaI	GGTCTC	1 cut(s)	75
BsaJI	CCNNGG	1 cut(s)	737
Bse3DI	GCAATG	1 cut(s)	480
BseDI	CCNNGG	1 cut(s)	737
BseGI	GGATG	3 cut(s)	335, 377, 730
BseMI	GCAATG	1 cut(s)	480
Bsh1236I	CGCG	2 cut(s)	12, 116
BshFI	GGCC	2 cut(s)	99, 476
BslFI	GGGAC	1 cut(s)	407
BsmAI	GTCTC	2 cut(s)	75, 623
BsmFI	GGGAC	1 cut(s)	407
BsnI	GGCC	2 cut(s)	99, 476
Bso31I	GGTCTC	1 cut(s)	75
Bsp143I	GATC	2 cut(s)	183, 226
Bsp19I	CCATGG	1 cut(s)	737
BspACI	CCGC	2 cut(s)	7, 10
BspANI	GGCC	2 cut(s)	99, 476
BspFNI	CGCG	2 cut(s)	12, 116
BspHI	TCATGA	1 cut(s)	523
BspLI	GGNNCC	2 cut(s)	185, 735
BspPI	GGATC	2 cut(s)	178, 191
BspQI	GCTCTTC	2 cut(s)	22, 615
BspTNI	GGTCTC	1 cut(s)	75
BsrDI	GCAATG	1 cut(s)	480
BssECI	CCNNGG	1 cut(s)	737
BssMI	GATC	2 cut(s)	183, 226
BssNAI	GTATAC	1 cut(s)	443
BssT1I	CCWWGG	1 cut(s)	737
Bst1107I	GTATAC	1 cut(s)	443
Bst4CI	ACNGT	3 cut(s)	236, 398, 507
Bst6I	CTCTTC	2 cut(s)	22, 615
BstC8I	GCNNGC	2 cut(s)	538, 744
BstDSI	CCRYGG	1 cut(s)	737
BstF5I	GGATG	3 cut(s)	335, 377, 730
BstFNI	CGCG	2 cut(s)	12, 116
BstH2I	RGCGCY	1 cut(s)	178
BstHHI	GCGC	1 cut(s)	177
BstKTI	GATC	2 cut(s)	186, 229
BstMAI	GTCTC	2 cut(s)	75, 623
BstMBI	GATC	2 cut(s)	183, 226
BstMWI	GCNNNNNNNGC	2 cut(s)	320, 482
BstNSI	RCATGY	1 cut(s)	294
BstUI	CGCG	2 cut(s)	12, 116
BstX2I	RGATCY	1 cut(s)	183
BstYI	RGATCY	1 cut(s)	183
BstZ17I	GTATAC	1 cut(s)	443
BsuRI	GGCC	2 cut(s)	99, 476
BtgI	CCRYGG	1 cut(s)	737
BtsCI	GGATG	3 cut(s)	335, 377, 730
BtsIMutI	CAGTG	1 cut(s)	258
Cac8I	GCNNGC	2 cut(s)	538, 744
CciI	TCATGA	1 cut(s)	523
CfoI	GCGC	1 cut(s)	177
Cfr13I	GGNCC	3 cut(s)	56, 452, 553
CseI	GACGC	1 cut(s)	122
CspCI	CAANNNNNGTGG	2 cut(s)	337, 372
CviAII	CATG	4 cut(s)	291, 524, 699, 738
DpnI	GATC	2 cut(s)	185, 228
DpnII	GATC	2 cut(s)	183, 226
EaeI	YGGCCR	1 cut(s)	97
Eam1104I	CTCTTC	2 cut(s)	22, 615
EarI	CTCTTC	2 cut(s)	22, 615
Eco130I	CCWWGG	1 cut(s)	737
Eco31I	GGTCTC	1 cut(s)	75
Eco47I	GGWCC	3 cut(s)	56, 452, 553
Eco47III	AGCGCT	1 cut(s)	176
Eco57I	CTGAAG	1 cut(s)	530
EcoT14I	CCWWGG	1 cut(s)	737
ErhI	CCWWGG	1 cut(s)	737
FaeI	CATG	4 cut(s)	294, 527, 702, 741
FalI	AAGNNNNNCTT	6 cut(s)	417, 449, 609, 641, 662, 694
FaqI	GGGAC	1 cut(s)	407
FatI	CATG	4 cut(s)	290, 523, 698, 737
FbaI	TGATCA	1 cut(s)	226
FblI	GTMKAC	1 cut(s)	442
Fnu4HI	GCNGC	1 cut(s)	10
FokI	GGATG	3 cut(s)	322, 364, 737
Fsp4HI	GCNGC	1 cut(s)	10
FspBI	CTAG	3 cut(s)	287, 320, 533
GlaI	GCGC	1 cut(s)	176
GluI	GCNGC	1 cut(s)	10
GsuI	CTGGAG	1 cut(s)	191
HaeII	RGCGCY	1 cut(s)	178
HaeIII	GGCC	2 cut(s)	99, 476
HgaI	GACGC	1 cut(s)	122
HhaI	GCGC	1 cut(s)	177
Hin1II	CATG	4 cut(s)	294, 527, 702, 741
Hin6I	GCGC	1 cut(s)	175
HinP1I	GCGC	1 cut(s)	175
HindIII	AAGCTT	3 cut(s)	154, 198, 383
HinfI	GANTC	2 cut(s)	275, 517
HphI	GGTGA	1 cut(s)	270
Hpy166II	GTNNAC	3 cut(s)	431, 443, 676
Hpy188I	TCNGA	3 cut(s)	112, 188, 613
Hpy188III	TCNNGA	6 cut(s)	204, 224, 455, 524, 562, 684
Hpy8I	GTNNAC	3 cut(s)	431, 443, 676
Hpy99I	CGWCG	1 cut(s)	116
HpyAV	CCTTC	4 cut(s)	17, 43, 551, 715
HpyCH4III	ACNGT	3 cut(s)	236, 398, 507
HpyCH4V	TGCA	4 cut(s)	195, 374, 407, 746
HpyF10VI	GCNNNNNNNGC	2 cut(s)	320, 482
Hsp92II	CATG	4 cut(s)	294, 527, 702, 741
HspAI	GCGC	1 cut(s)	175
Ksp22I	TGATCA	1 cut(s)	226
Kzo9I	GATC	2 cut(s)	183, 226
LguI	GCTCTTC	2 cut(s)	22, 615
LmnI	GCTCC	2 cut(s)	172, 733
LweI	GCATC	1 cut(s)	383
MaeI	CTAG	3 cut(s)	287, 320, 533
MaeIII	GTNAC	2 cut(s)	142, 215
MalI	GATC	2 cut(s)	185, 228
MboI	GATC	2 cut(s)	183, 226
MboII	GAAGA	4 cut(s)	39, 512, 536, 632
MflI	RGATCY	1 cut(s)	183
MluCI	AATT	4 cut(s)	190, 565, 606, 642
MluI	ACGCGT	1 cut(s)	114
MmeI	TCCRAC	1 cut(s)	135
MnlI	CCTC	6 cut(s)	82, 142, 238, 349, 540, 680
MseI	TTAA	3 cut(s)	300, 387, 757
MvnI	CGCG	2 cut(s)	12, 116
MwoI	GCNNNNNNNGC	2 cut(s)	320, 482
NcoI	CCATGG	1 cut(s)	737
NdeII	GATC	2 cut(s)	183, 226
NlaIII	CATG	4 cut(s)	294, 527, 702, 741
NlaIV	GGNNCC	2 cut(s)	185, 735
NmuCI	GTSAC	2 cut(s)	142, 215
NspI	RCATGY	1 cut(s)	294
PagI	TCATGA	1 cut(s)	523
PciSI	GCTCTTC	2 cut(s)	22, 615
PfeI	GAWTC	2 cut(s)	275, 517
PkrI	GCNGC	1 cut(s)	11
PspN4I	GGNNCC	2 cut(s)	185, 735
PspPI	GGNCC	3 cut(s)	56, 452, 553
PsuI	RGATCY	1 cut(s)	183
SapI	GCTCTTC	2 cut(s)	22, 615
SaqAI	TTAA	3 cut(s)	300, 387, 757
SatI	GCNGC	1 cut(s)	10
Sau3AI	GATC	2 cut(s)	183, 226
Sau96I	GGNCC	3 cut(s)	56, 452, 553
SfaNI	GCATC	1 cut(s)	383
SinI	GGWCC	3 cut(s)	56, 452, 553
SmlI	CTYRAG	2 cut(s)	626, 682
SmoI	CTYRAG	2 cut(s)	626, 682
Sse9I	AATT	4 cut(s)	190, 565, 606, 642
SsiI	CCGC	2 cut(s)	7, 10
SspI	AATATT	1 cut(s)	269
SspMI	CTAG	3 cut(s)	287, 320, 533
StyI	CCWWGG	1 cut(s)	737
TaaI	ACNGT	3 cut(s)	236, 398, 507
TaqI	TCGA	2 cut(s)	159, 719
TasI	AATT	4 cut(s)	190, 565, 606, 642
TauI	GCSGC	1 cut(s)	12
TfiI	GAWTC	2 cut(s)	275, 517
Tru1I	TTAA	3 cut(s)	300, 387, 757
Tru9I	TTAA	3 cut(s)	300, 387, 757
TscAI	CASTG	1 cut(s)	258
TseFI	GTSAC	2 cut(s)	142, 215
Tsp45I	GTSAC	2 cut(s)	142, 215
TspDTI	ATGAA	8 cut(s)	17, 62, 288, 318, 512, 540, 654, 741
TspGWI	ACGGA	2 cut(s)	130, 545
TspRI	CASTG	1 cut(s)	258
VpaK11BI	GGWCC	3 cut(s)	56, 452, 553
XapI	RAATTY	2 cut(s)	565, 606
XceI	RCATGY	1 cut(s)	294
XmiI	GTMKAC	1 cut(s)	442
XspI	CTAG	3 cut(s)	287, 320, 533

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.