Rmu_sc0012235.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012235.1
OG0002925
Physical Location & Seq
Reverse (-)
25414 .. 25990
577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012235.1_g000007.1.cds

Sequence Viewer

Length: 402 bp
atggtgtggatggtaactcaacagtttgtgattaaaggaaagagaaggcgcatatggggaggagcttttctctgttgggtgctgttaatgttggtcactcccaaaatttctcactccccaaatcaccatcactatgctgacatgcgcaatttccttggagtgcccaacacattgaatgtgatcaccagtttcccattcttggttgttggggttctgggttttgttctctgtgtccaaggaggctttttcaatatcagtttgccaggtgaagtttggggttgggcactgttctatgcaggaatagcagggctggcttttgggtctgcttattatcatttgaagcctgatgatagtagagtgacttgggataccttgccggttagcatttcaatttctttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ceramidase

Protein Analysis

133

Amino Acids

14.95

Weight (kDa)

9.39

Isoelectric Point (pI)

40.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 146
AcsI RAATTY 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 4 cut(s) 175, 250, 340, 390
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
ApoI RAATTY 1 cut(s) 105
AspLEI GCGC 2 cut(s) 51, 147
AsuHPI GGTGA 3 cut(s) 116, 175, 278
BaeGI GKGCMC 2 cut(s) 165, 286
BccI CCATC 2 cut(s) 4, 135
BciT130I CCWGG 1 cut(s) 264
BciVI GTATCC 1 cut(s) 361
BclI TGATCA 1 cut(s) 180
BfaI CTAG 1 cut(s) 400
BfuI GTATCC 1 cut(s) 361
Bme1390I CCNGG 1 cut(s) 264
BmrFI CCNGG 1 cut(s) 264
BplI GAGNNNNNCTC 2 cut(s) 54, 86
BsaJI CCNNGG 2 cut(s) 154, 235
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse118I RCCGGY 1 cut(s) 376
Bse1I ACTGG 1 cut(s) 186
BseBI CCWGG 1 cut(s) 264
BseDI CCNNGG 2 cut(s) 154, 235
BseGI GGATG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 199
BseNI ACTGG 1 cut(s) 186
BseRI GAGGAG 1 cut(s) 75
BseSI GKGCMC 2 cut(s) 165, 286
BsiSI CCGG 1 cut(s) 377
BslI CCNNNNNNNGG 1 cut(s) 199
Bsp1286I GDGCHC 2 cut(s) 165, 286
Bsp143I GATC 1 cut(s) 180
BsrFI RCCGGY 1 cut(s) 376
BsrI ACTGG 1 cut(s) 186
BssAI RCCGGY 1 cut(s) 376
BssECI CCNNGG 2 cut(s) 154, 235
BssMI GATC 1 cut(s) 180
BssT1I CCWWGG 2 cut(s) 154, 235
Bst2UI CCWGG 1 cut(s) 264
Bst4CI ACNGT 2 cut(s) 24, 288
BstC8I GCNNGC 1 cut(s) 312
BstF5I GGATG 1 cut(s) 15
BstHHI GCGC 2 cut(s) 51, 147
BstKTI GATC 1 cut(s) 183
BstMBI GATC 1 cut(s) 180
BstMWI GCNNNNNNNGC 2 cut(s) 302, 311
BstNI CCWGG 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 262
BstSLI GKGCMC 2 cut(s) 165, 286
BsuI GTATCC 1 cut(s) 361
BtsCI GGATG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 284
Cac8I GCNNGC 1 cut(s) 312
CfoI GCGC 2 cut(s) 51, 147
Cfr10I RCCGGY 1 cut(s) 376
CviAII CATG 1 cut(s) 142
CviJI RGCY 5 cut(s) 65, 243, 310, 314, 343
CviKI_1 RGCY 5 cut(s) 65, 243, 310, 314, 343
DpnI GATC 1 cut(s) 182
DpnII GATC 1 cut(s) 180
Eco130I CCWWGG 2 cut(s) 154, 235
EcoRII CCWGG 1 cut(s) 262
EcoT14I CCWWGG 2 cut(s) 154, 235
ErhI CCWWGG 2 cut(s) 154, 235
FaeI CATG 1 cut(s) 145
FaiI YATR 5 cut(s) 53, 55, 135, 143, 294
FatI CATG 1 cut(s) 141
FauNDI CATATG 1 cut(s) 53
FbaI TGATCA 1 cut(s) 180
FokI GGATG 1 cut(s) 22
FspBI CTAG 1 cut(s) 400
FspI TGCGCA 1 cut(s) 146
GlaI GCGC 2 cut(s) 50, 146
HapII CCGG 1 cut(s) 377
HhaI GCGC 2 cut(s) 51, 147
Hin1II CATG 1 cut(s) 145
Hin6I GCGC 2 cut(s) 49, 145
HinP1I GCGC 2 cut(s) 49, 145
HpaII CCGG 1 cut(s) 377
HphI GGTGA 3 cut(s) 116, 175, 278
HpyAV CCTTC 1 cut(s) 39
HpyCH4III ACNGT 2 cut(s) 24, 288
HpyCH4V TGCA 1 cut(s) 296
HpyF10VI GCNNNNNNNGC 2 cut(s) 302, 311
Hsp92II CATG 1 cut(s) 145
HspAI GCGC 2 cut(s) 49, 145
Ksp22I TGATCA 1 cut(s) 180
Kzo9I GATC 1 cut(s) 180
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 9 cut(s) 199, 200, 249, 276, 282, 291, 296, 357, 390
MaeI CTAG 1 cut(s) 400
MaeIII GTNAC 3 cut(s) 13, 94, 358
MalI GATC 1 cut(s) 182
MboI GATC 1 cut(s) 180
MhlI GDGCHC 2 cut(s) 165, 286
MluCI AATT 3 cut(s) 105, 148, 390
MnlI CCTC 2 cut(s) 53, 233
MseI TTAA 2 cut(s) 33, 86
MslI CAYNNNNRTG 1 cut(s) 132
MspI CCGG 1 cut(s) 377
MspR9I CCNGG 1 cut(s) 264
MvaI CCWGG 1 cut(s) 264
MwoI GCNNNNNNNGC 2 cut(s) 302, 311
NdeI CATATG 1 cut(s) 53
NdeII GATC 1 cut(s) 180
NlaIII CATG 1 cut(s) 145
NmuCI GTSAC 2 cut(s) 94, 358
NsbI TGCGCA 1 cut(s) 146
NspI RCATGY 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 2 cut(s) 33, 86
Sau3AI GATC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 264
SduI GDGCHC 2 cut(s) 165, 286
SetI ASST 3 cut(s) 67, 268, 374
SmiMI CAYNNNNRTG 1 cut(s) 132
Sse9I AATT 3 cut(s) 105, 148, 390
SspMI CTAG 1 cut(s) 400
StyD4I CCNGG 1 cut(s) 262
StyI CCWWGG 2 cut(s) 154, 235
TaaI ACNGT 2 cut(s) 24, 288
TasI AATT 3 cut(s) 105, 148, 390
Tru1I TTAA 2 cut(s) 33, 86
Tru9I TTAA 2 cut(s) 33, 86
TscAI CASTG 1 cut(s) 291
TseFI GTSAC 2 cut(s) 94, 358
Tsp45I GTSAC 2 cut(s) 94, 358
TspRI CASTG 1 cut(s) 291
XapI RAATTY 1 cut(s) 105
XceI RCATGY 1 cut(s) 145
XcmI CCANNNNNNNNNTGG 1 cut(s) 270
XspI CTAG 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.