Rmu_sc0012351.1_g000009

Soluble inorganic

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012351.1
Physical Location & Seq
Reverse (-)
43504 .. 45684
2181 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012351.1_g000009.1.cds

Sequence Viewer

Length: 711 bp
atggctccacccattgaggctactcaaacagttactgagattccccaaaaagttgctgaagttcctaagaaagttactgagactccccacaagggtagcaaccattattcctcacatcctcctcttaatgagaggatactttcttccatgaccaggaggtctatagctgcacacccttggcatgatcttgaaataggacctgatactccaaagatctttaactgtgttatagaaattggaaaaggaagcaaggtgaaatatgaacttgacaaaaaaactggacttatcaaggttgaccgtatactgtactcatctgttgtctaccctcacaactatggcttcatcccccgtacgctttgtgaggacaatgaccccttggatgtcttgattattatgcaggagccagttcttcctggatgctttcttcgggctaaagctattggcctgatgcccatgattgatcagggtgagaaagatgacaagatcattgctgtttgtgctgatgatcctgaataccgtcattacaatgacatcaaggagctgccaccacatcgtttggctgagatccgtcgcttctttgaggactacaagaaaaatgagaacaaggaggttttagttgatgactttctccctgcatctgctgcctttgaaagtatccagcagtccatggatctttatgcggactacattgtggagagcctcaggcggtag
Functional Annotation

Protein Analysis

236

Amino Acids

26.94

Weight (kDa)

5.65

Isoelectric Point (pI)

48.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 157
AccI GTMKAC 2 cut(s) 301, 321
AciI CCGC 2 cut(s) 680, 706
AclWI GGATC 3 cut(s) 500, 559, 678
AcuI CTGAAG 1 cut(s) 78
AfaI GTAC 2 cut(s) 308, 352
AfiI CCNNNNNNNGG 2 cut(s) 92, 153
AgsI TTSAA 2 cut(s) 191, 650
AjnI CCWGG 2 cut(s) 152, 412
AluBI AGCT 3 cut(s) 167, 437, 541
AluI AGCT 3 cut(s) 167, 437, 541
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 3 cut(s) 500, 559, 678
AlwNI CAGNNNCTG 1 cut(s) 35
AoxI GGCC 1 cut(s) 442
ApeKI GCWGC 3 cut(s) 167, 541, 641
AspS9I GGNCC 1 cut(s) 197
AsuHPI GGTGA 2 cut(s) 265, 479
AvaII GGWCC 1 cut(s) 197
AxyI CCTNAGG 1 cut(s) 701
BbvI GCAGC 3 cut(s) 154, 528, 628
BciT130I CCWGG 2 cut(s) 154, 414
BciVI GTATCC 2 cut(s) 129, 665
BclI TGATCA 1 cut(s) 460
BcoDI GTCTC 1 cut(s) 74
BfmI CTRYAG 1 cut(s) 162
BfuI GTATCC 2 cut(s) 129, 665
BglII AGATCT 1 cut(s) 213
BisI GCNGC 3 cut(s) 168, 542, 642
BlsI GCNGC 3 cut(s) 169, 543, 643
Bme1390I CCNGG 2 cut(s) 154, 414
Bme18I GGWCC 1 cut(s) 197
BmgT120I GGNCC 1 cut(s) 197
BmiI GGNNCC 2 cut(s) 6, 402
BmrFI CCNGG 2 cut(s) 154, 414
BmsI GCATC 3 cut(s) 407, 438, 644
BsaJI CCNNGG 3 cut(s) 176, 375, 666
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bsc4I CCNNNNNNNGG 2 cut(s) 92, 153
Bse1I ACTGG 2 cut(s) 283, 404
Bse21I CCTNAGG 1 cut(s) 701
Bse3DI GCAATG 1 cut(s) 486
BseBI CCWGG 2 cut(s) 154, 414
BseDI CCNNGG 3 cut(s) 176, 375, 666
BseGI GGATG 4 cut(s) 115, 342, 385, 422
BseLI CCNNNNNNNGG 2 cut(s) 92, 153
BseMI GCAATG 1 cut(s) 486
BseMII CTCAG 3 cut(s) 27, 69, 552
BseNI ACTGG 2 cut(s) 283, 404
BseRI GAGGAG 1 cut(s) 111
BseXI GCAGC 3 cut(s) 154, 528, 628
BsgI GTGCAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 444
BsiWI CGTACG 1 cut(s) 350
BslI CCNNNNNNNGG 2 cut(s) 92, 153
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 444
Bsp143I GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
Bsp19I CCATGG 1 cut(s) 666
BspACI CCGC 2 cut(s) 680, 706
BspANI GGCC 1 cut(s) 444
BspCNI CTCAG 3 cut(s) 28, 70, 553
BspLI GGNNCC 2 cut(s) 6, 402
BspPI GGATC 3 cut(s) 500, 559, 678
BsrDI GCAATG 1 cut(s) 486
BsrI ACTGG 2 cut(s) 283, 404
BssECI CCNNGG 3 cut(s) 176, 375, 666
BssMI GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
BssNAI GTATAC 1 cut(s) 302
BssT1I CCWWGG 3 cut(s) 176, 375, 666
Bst1107I GTATAC 1 cut(s) 302
Bst2UI CCWGG 2 cut(s) 154, 414
Bst4CI ACNGT 5 cut(s) 31, 224, 299, 306, 518
BstAPI GCANNNNNTGC 1 cut(s) 641
BstDEI CTNAG 5 cut(s) 36, 66, 78, 561, 701
BstDSI CCRYGG 1 cut(s) 666
BstF5I GGATG 4 cut(s) 115, 342, 385, 422
BstKTI GATC 7 cut(s) 187, 216, 463, 486, 508, 567, 673
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
BstMWI GCNNNNNNNGC 2 cut(s) 497, 641
BstNI CCWGG 2 cut(s) 154, 414
BstSCI CCNGG 2 cut(s) 152, 412
BstSFI CTRYAG 1 cut(s) 162
BstV1I GCAGC 3 cut(s) 154, 528, 628
BstX2I RGATCY 3 cut(s) 213, 564, 670
BstYI RGATCY 3 cut(s) 213, 564, 670
BstZ17I GTATAC 1 cut(s) 302
Bsu36I CCTNAGG 1 cut(s) 701
BsuI GTATCC 2 cut(s) 129, 665
BsuRI GGCC 1 cut(s) 444
BtgI CCRYGG 1 cut(s) 666
BtsCI GGATG 4 cut(s) 115, 342, 385, 422
CaiI CAGNNNCTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 197
Csp6I GTAC 2 cut(s) 307, 351
CspCI CAANNNNNGTGG 2 cut(s) 537, 572
CviAII CATG 4 cut(s) 148, 182, 454, 667
CviQI GTAC 2 cut(s) 307, 351
DdeI CTNAG 5 cut(s) 36, 66, 78, 561, 701
DpnI GATC 7 cut(s) 186, 215, 462, 485, 507, 566, 672
DpnII GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
DrdI GACNNNNNNGTC 1 cut(s) 157
DseDI GACNNNNNNGTC 1 cut(s) 157
Eco130I CCWWGG 3 cut(s) 176, 375, 666
Eco47I GGWCC 1 cut(s) 197
Eco57I CTGAAG 1 cut(s) 78
Eco81I CCTNAGG 1 cut(s) 701
EcoO109I RGGNCCY 1 cut(s) 197
EcoRII CCWGG 2 cut(s) 152, 412
EcoT14I CCWWGG 3 cut(s) 176, 375, 666
ErhI CCWWGG 3 cut(s) 176, 375, 666
FaeI CATG 4 cut(s) 151, 185, 457, 670
FatI CATG 4 cut(s) 147, 181, 453, 666
FbaI TGATCA 1 cut(s) 460
FblI GTMKAC 2 cut(s) 301, 321
Fnu4HI GCNGC 3 cut(s) 168, 542, 642
FokI GGATG 4 cut(s) 102, 329, 392, 429
Fsp4HI GCNGC 3 cut(s) 168, 542, 642
GluI GCNGC 3 cut(s) 168, 542, 642
HaeIII GGCC 1 cut(s) 444
Hin1II CATG 4 cut(s) 151, 185, 457, 670
HincII GTYRAC 1 cut(s) 295
HindII GTYRAC 1 cut(s) 295
HinfI GANTC 2 cut(s) 40, 82
HphI GGTGA 2 cut(s) 265, 479
Hpy166II GTNNAC 3 cut(s) 295, 302, 322
Hpy188III TCNNGA 3 cut(s) 188, 385, 509
Hpy8I GTNNAC 3 cut(s) 295, 302, 322
Hpy99I CGWCG 1 cut(s) 573
HpyCH4III ACNGT 5 cut(s) 31, 224, 299, 306, 518
HpyCH4V TGCA 3 cut(s) 170, 397, 635
HpyF10VI GCNNNNNNNGC 2 cut(s) 497, 641
HpyF3I CTNAG 5 cut(s) 36, 66, 78, 561, 701
Hsp92II CATG 4 cut(s) 151, 185, 457, 670
Ksp22I TGATCA 1 cut(s) 460
Kzo9I GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
LmnI GCTCC 3 cut(s) 10, 400, 538
Lsp1109I GCAGC 3 cut(s) 154, 528, 628
LweI GCATC 3 cut(s) 407, 438, 644
MaeIII GTNAC 2 cut(s) 31, 73
MalI GATC 7 cut(s) 186, 215, 462, 485, 507, 566, 672
MboI GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
MboII GAAGA 3 cut(s) 135, 401, 416
MflI RGATCY 3 cut(s) 213, 564, 670
MluCI AATT 1 cut(s) 234
MlyI GAGTC 1 cut(s) 76
MseI TTAA 2 cut(s) 126, 219
MslI CAYNNNNRTG 2 cut(s) 333, 525
MspR9I CCNGG 2 cut(s) 154, 414
MvaI CCWGG 2 cut(s) 154, 414
MwoI GCNNNNNNNGC 2 cut(s) 497, 641
NcoI CCATGG 1 cut(s) 666
NdeII GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
NlaIII CATG 4 cut(s) 151, 185, 457, 670
NlaIV GGNNCC 2 cut(s) 6, 402
PfeI GAWTC 1 cut(s) 40
Pfl23II CGTACG 1 cut(s) 350
PfoI TCCNGGA 1 cut(s) 412
PkrI GCNGC 3 cut(s) 169, 543, 643
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
PpuMI RGGWCCY 1 cut(s) 197
Psp5II RGGWCCY 1 cut(s) 197
Psp6I CCWGG 2 cut(s) 152, 412
PspGI CCWGG 2 cut(s) 152, 412
PspLI CGTACG 1 cut(s) 350
PspN4I GGNNCC 2 cut(s) 6, 402
PspPI GGNCC 1 cut(s) 197
PspPPI RGGWCCY 1 cut(s) 197
PstNI CAGNNNCTG 1 cut(s) 35
PsuI RGATCY 3 cut(s) 213, 564, 670
RsaI GTAC 2 cut(s) 308, 352
RsaNI GTAC 2 cut(s) 307, 351
RseI CAYNNNNRTG 2 cut(s) 333, 525
SaqAI TTAA 2 cut(s) 126, 219
SatI GCNGC 3 cut(s) 168, 542, 642
Sau3AI GATC 7 cut(s) 184, 213, 460, 483, 505, 564, 670
Sau96I GGNCC 1 cut(s) 197
SchI GAGTC 1 cut(s) 76
ScrFI CCNGG 2 cut(s) 154, 414
SetI ASST 8 cut(s) 161, 169, 202, 255, 294, 439, 543, 612
SfaNI GCATC 3 cut(s) 407, 438, 644
SfcI CTRYAG 1 cut(s) 162
SinI GGWCC 1 cut(s) 197
SmiMI CAYNNNNRTG 2 cut(s) 333, 525
Sse9I AATT 1 cut(s) 234
SsiI CCGC 2 cut(s) 680, 706
StyD4I CCNGG 2 cut(s) 152, 412
StyI CCWWGG 3 cut(s) 176, 375, 666
TaaI ACNGT 5 cut(s) 31, 224, 299, 306, 518
TasI AATT 1 cut(s) 234
TatI WGTACW 1 cut(s) 306
TfiI GAWTC 1 cut(s) 40
Tru1I TTAA 2 cut(s) 126, 219
Tru9I TTAA 2 cut(s) 126, 219
TseI GCWGC 3 cut(s) 167, 541, 641
TspDTI ATGAA 2 cut(s) 276, 331
TspGWI ACGGA 1 cut(s) 557
VpaK11BI GGWCC 1 cut(s) 197
XmiI GTMKAC 2 cut(s) 301, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.