Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012559.1

Orthogroup ID

OG0001313

Physical Location & Seq

Genomic Coordinates Forward (+)

13235 .. 14834

Gene Structure 1600 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012559.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 672 bp

atggcggaggccccgccgacgacgacgcatcaccggagatcgttgtccgactttgccgccgtgtcgctgagcggactgttcggaggcggaggaggaggaggaggaggaggagatgatcagagaggcggaggcggaggaggaggtggaggtggaggagtagtaggcgcagggtcgacgtttgagtatttcggttgggtgtatcatttgggagtcaattccatcggccacgagtactgtcacctccggtttctcttcatccgaggcaagtatgtcgagatgtacaagcgtgatcctcacgaaaacccaggcattaaacctattaggaggggcgttgttggacctacactgatgctagaggaggttgggcgtcggaaggtgtactatggggatgtttatgttctgcggttttacaatcgattggacgaatcaaagaagggggaaattgcttgtgctacggctgaagaagcccagaaatggctggaggcatttgaccaatccaagcaacaggctgagtatgagctgataagaggaggtagcgctagaaacaaactgagcatggaatccgagatcaaccttgatgaacatcgacctagagtgaggcgctatgcaagtggattgaaaaggcttataaaaattgggcaaggtgaggtggtatgtcaagggctactttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1336 START

Protein Analysis

223

Amino Acids

24.33

Weight (kDa)

8.91

Isoelectric Point (pI)

52.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001313)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35180 AT5G35180 AT5G35180 AT5G35180 AT5G35180
fragaria_vesca	FvH4_1g01530 FvH4_1g01530 FvH4_1g01530 FvH4_1g01530 FvH4_1g01530 FvH4_7g03330 FvH4_7g03330 FvH4_7g03330 FvH4_7g03330
malus_domestica	MD02G1283900.v1.1 MD07G1049900.v1.1 MD15G1157900.v1.1
prunus_persica	Prupe.2G038700_v2.0.a1 Prupe.2G038700_v2.0.a1 Prupe.2G038700_v2.0.a1 Prupe.2G038700_v2.0.a1 Prupe.7G253100_v2.0.a1 Prupe.7G253100_v2.0.a1 Prupe.7G253100_v2.0.a1 Prupe.7G253100_v2.0.a1
pyrus_communis	pycom02g24190 pycom07g03570 pycom15g14170
rosa_chinensis	RchiOBHm_Chr1g0325641 RchiOBHm_Chr2g0086461
rosa_laevigata	RLG00000015760 RLG00000030114
rosa_multiflora	Rmu_sc0000651.1_g000003 Rmu_sc0005127.1_g000002 Rmu_sc0012559.1_g000004 Rmu_sc0021008.1_g000001 Rmu_sc0021009.1_g000001
rosa_roxburghii	Rroxscaffold_2G00154560 Rroxscaffold_4G00324560
rosa_rugosa	Rorug01G0053300 Rorug01G0053400 Rorug01G0053500 Rorug01G0467400 Rorug01G0467400
rosa_samantha	Rh1AG069000 Rh1BG056400 Rh1CG069300 Rh1DG074000 Rh2AG018200 Rh2BG017800 Rh2CG018600 Rh2DG019500
rosa_wichuraiana	Rw1G005710 Rw2G001520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	629
AccBSI	CCGCTC	1 cut(s)	72
AccI	GTMKAC	1 cut(s)	173
AciI	CCGC	8 cut(s)	5, 14, 57, 72, 87, 126, 132, 403
AclWI	GGATC	1 cut(s)	284
AcoI	YGGCCR	1 cut(s)	223
AcuI	CTGAAG	1 cut(s)	480
AcyI	GRCGYC	1 cut(s)	367
AfaI	GTAC	3 cut(s)	233, 281, 380
AfeI	AGCGCT	1 cut(s)	538
AfiI	CCNNNNNNNGG	1 cut(s)	474
AgsI	TTSAA	1 cut(s)	619
AjnI	CCWGG	1 cut(s)	304
AluBI	AGCT	1 cut(s)	520
AluI	AGCT	1 cut(s)	520
AlwI	GGATC	1 cut(s)	284
Aor51HI	AGCGCT	1 cut(s)	538
AoxI	GGCC	2 cut(s)	9, 223
AspLEI	GCGC	3 cut(s)	167, 539, 603
AspS9I	GGNCC	2 cut(s)	10, 338
AsuHPI	GGTGA	3 cut(s)	23, 230, 656
AvaII	GGWCC	1 cut(s)	338
BauI	CACGAG	1 cut(s)	227
BccI	CCATC	1 cut(s)	227
BceAI	ACGGC	2 cut(s)	44, 471
BcgI	CGANNNNNNTGC	2 cut(s)	253, 287
BciT130I	CCWGG	1 cut(s)	306
BclI	TGATCA	1 cut(s)	115
BfaI	CTAG	3 cut(s)	353, 540, 591
BfoI	RGCGCY	2 cut(s)	540, 604
BisI	GCNGC	1 cut(s)	57
BlpI	GCTNAGC	1 cut(s)	68
BlsI	GCNGC	1 cut(s)	58
BmcAI	AGTACT	1 cut(s)	233
Bme1390I	CCNGG	1 cut(s)	306
Bme18I	GGWCC	1 cut(s)	338
BmgT120I	GGNCC	2 cut(s)	10, 338
BmiI	GGNNCC	1 cut(s)	12
BmrFI	CCNGG	1 cut(s)	306
BmsI	GCATC	2 cut(s)	37, 339
BpmI	CTGGAG	1 cut(s)	500
Bpu1102I	GCTNAGC	1 cut(s)	68
Bsa29I	ATCGAT	1 cut(s)	415
BsaBI	GATNNNNATC	1 cut(s)	582
BsaHI	GRCGYC	1 cut(s)	367
BsaJI	CCNNGG	2 cut(s)	259, 304
BsaWI	WCCGGW	2 cut(s)	33, 243
BsaXI	ACNNNNNCTCC	2 cut(s)	144, 174
Bsc4I	CCNNNNNNNGG	1 cut(s)	474
Bse8I	GATNNNNATC	1 cut(s)	582
BseBI	CCWGG	1 cut(s)	306
BseCI	ATCGAT	1 cut(s)	415
BseDI	CCNNGG	2 cut(s)	259, 304
BseGI	GGATG	2 cut(s)	255, 394
BseJI	GATNNNNATC	1 cut(s)	582
BseLI	CCNNNNNNNGG	1 cut(s)	474
BseMII	CTCAG	3 cut(s)	59, 501, 542
BshFI	GGCC	2 cut(s)	11, 225
BshVI	ATCGAT	1 cut(s)	415
BsiSI	CCGG	2 cut(s)	34, 244
BslI	CCNNNNNNNGG	1 cut(s)	474
BsnI	GGCC	2 cut(s)	11, 225
Bsp1407I	TGTACA	1 cut(s)	279
Bsp143I	GATC	4 cut(s)	38, 115, 289, 567
Bsp1720I	GCTNAGC	1 cut(s)	68
BspACI	CCGC	8 cut(s)	5, 14, 57, 72, 87, 126, 132, 403
BspANI	GGCC	2 cut(s)	11, 225
BspCNI	CTCAG	3 cut(s)	60, 502, 543
BspDI	ATCGAT	1 cut(s)	415
BspLI	GGNNCC	1 cut(s)	12
BspPI	GGATC	1 cut(s)	284
BsrBI	CCGCTC	1 cut(s)	72
BsrGI	TGTACA	1 cut(s)	279
BssECI	CCNNGG	2 cut(s)	259, 304
BssMI	GATC	4 cut(s)	38, 115, 289, 567
BssNI	GRCGYC	1 cut(s)	367
BssSI	CACGAG	1 cut(s)	227
Bst2BI	CACGAG	1 cut(s)	227
Bst2UI	CCWGG	1 cut(s)	306
Bst4CI	ACNGT	2 cut(s)	78, 236
Bst6I	CTCTTC	1 cut(s)	257
BstACI	GRCGYC	1 cut(s)	367
BstAUI	TGTACA	1 cut(s)	279
BstDEI	CTNAG	3 cut(s)	68, 510, 551
BstF5I	GGATG	2 cut(s)	255, 394
BstH2I	RGCGCY	2 cut(s)	540, 604
BstHHI	GCGC	3 cut(s)	167, 539, 603
BstKTI	GATC	4 cut(s)	41, 118, 292, 570
BstMBI	GATC	4 cut(s)	38, 115, 289, 567
BstMWI	GCNNNNNNNGC	1 cut(s)	464
BstNI	CCWGG	1 cut(s)	306
BstSCI	CCNGG	1 cut(s)	304
Bsu15I	ATCGAT	1 cut(s)	415
BsuRI	GGCC	2 cut(s)	11, 225
BsuTUI	ATCGAT	1 cut(s)	415
BtsCI	GGATG	2 cut(s)	255, 394
BtsIMutI	CAGTG	1 cut(s)	344
CfoI	GCGC	3 cut(s)	167, 539, 603
Cfr13I	GGNCC	2 cut(s)	10, 338
ClaI	ATCGAT	1 cut(s)	415
CseI	GACGC	2 cut(s)	34, 356
Csp6I	GTAC	3 cut(s)	232, 280, 379
CviAII	CATG	1 cut(s)	556
CviJI	RGCY	9 cut(s)	11, 225, 458, 467, 478, 509, 520, 625, 664
CviKI_1	RGCY	9 cut(s)	11, 225, 458, 467, 478, 509, 520, 625, 664
CviQI	GTAC	3 cut(s)	232, 280, 379
DdeI	CTNAG	3 cut(s)	68, 510, 551
DpnI	GATC	4 cut(s)	40, 117, 291, 569
DpnII	GATC	4 cut(s)	38, 115, 289, 567
EaeI	YGGCCR	1 cut(s)	223
Eam1104I	CTCTTC	1 cut(s)	257
EarI	CTCTTC	1 cut(s)	257
EciI	GGCGGA	4 cut(s)	20, 102, 141, 147
Eco47I	GGWCC	1 cut(s)	338
Eco47III	AGCGCT	1 cut(s)	538
Eco57I	CTGAAG	1 cut(s)	480
EcoO109I	RGGNCCY	1 cut(s)	10
EcoRII	CCWGG	1 cut(s)	304
FaeI	CATG	1 cut(s)	559
FaiI	YATR	8 cut(s)	270, 384, 396, 516, 557, 606, 629, 655
FalI	AAGNNNNNCTT	1 cut(s)	651
FatI	CATG	1 cut(s)	555
FauI	CCCGC	1 cut(s)	21
FbaI	TGATCA	1 cut(s)	115
FblI	GTMKAC	1 cut(s)	173
Fnu4HI	GCNGC	1 cut(s)	57
FokI	GGATG	2 cut(s)	242, 401
Fsp4HI	GCNGC	1 cut(s)	57
FspBI	CTAG	3 cut(s)	353, 540, 591
GlaI	GCGC	3 cut(s)	166, 538, 602
GluI	GCNGC	1 cut(s)	57
GsuI	CTGGAG	1 cut(s)	500
HaeII	RGCGCY	2 cut(s)	540, 604
HaeIII	GGCC	2 cut(s)	11, 225
HapII	CCGG	2 cut(s)	34, 244
HgaI	GACGC	2 cut(s)	34, 356
HhaI	GCGC	3 cut(s)	167, 539, 603
Hin1I	GRCGYC	1 cut(s)	367
Hin1II	CATG	1 cut(s)	559
Hin6I	GCGC	3 cut(s)	165, 537, 601
HinP1I	GCGC	3 cut(s)	165, 537, 601
HincII	GTYRAC	1 cut(s)	174
HindII	GTYRAC	1 cut(s)	174
HinfI	GANTC	3 cut(s)	210, 425, 560
HpaII	CCGG	2 cut(s)	34, 244
HphI	GGTGA	3 cut(s)	23, 230, 656
Hpy166II	GTNNAC	2 cut(s)	174, 379
Hpy188I	TCNGA	6 cut(s)	49, 83, 120, 260, 372, 565
Hpy188III	TCNNGA	2 cut(s)	274, 296
Hpy8I	GTNNAC	2 cut(s)	174, 379
Hpy99I	CGWCG	5 cut(s)	22, 25, 28, 178, 372
HpyAV	CCTTC	2 cut(s)	367, 427
HpyCH4III	ACNGT	2 cut(s)	78, 236
HpyCH4IV	ACGT	1 cut(s)	176
HpyCH4V	TGCA	1 cut(s)	608
HpyF10VI	GCNNNNNNNGC	1 cut(s)	464
HpyF3I	CTNAG	3 cut(s)	68, 510, 551
HpySE526I	ACGT	1 cut(s)	176
Hsp92I	GRCGYC	1 cut(s)	367
Hsp92II	CATG	1 cut(s)	559
HspAI	GCGC	3 cut(s)	165, 537, 601
Ksp22I	TGATCA	1 cut(s)	115
Kzo9I	GATC	4 cut(s)	38, 115, 289, 567
LpnPI	CCDG	8 cut(s)	47, 153, 257, 291, 318, 464, 482, 491
LweI	GCATC	2 cut(s)	37, 339
MaeI	CTAG	3 cut(s)	353, 540, 591
MaeII	ACGT	1 cut(s)	176
MaeIII	GTNAC	1 cut(s)	236
MalI	GATC	4 cut(s)	40, 117, 291, 569
MbiI	CCGCTC	1 cut(s)	72
MboI	GATC	4 cut(s)	38, 115, 289, 567
MboII	GAAGA	2 cut(s)	244, 473
MluCI	AATT	3 cut(s)	214, 441, 633
MlyI	GAGTC	1 cut(s)	219
MmeI	TCCRAC	3 cut(s)	72, 316, 350
MseI	TTAA	2 cut(s)	312, 670
MspI	CCGG	2 cut(s)	34, 244
MspR9I	CCNGG	1 cut(s)	306
MvaI	CCWGG	1 cut(s)	306
MwoI	GCNNNNNNNGC	1 cut(s)	464
NdeII	GATC	4 cut(s)	38, 115, 289, 567
NlaIII	CATG	1 cut(s)	559
NlaIV	GGNNCC	1 cut(s)	12
NmuCI	GTSAC	1 cut(s)	236
PfeI	GAWTC	2 cut(s)	425, 560
PkrI	GCNGC	1 cut(s)	58
PleI	GAGTC	1 cut(s)	218
PpsI	GAGTC	1 cut(s)	218
PsiI	TTATAA	1 cut(s)	629
Psp6I	CCWGG	1 cut(s)	304
PspGI	CCWGG	1 cut(s)	304
PspN4I	GGNNCC	1 cut(s)	12
PspPI	GGNCC	2 cut(s)	10, 338
RsaI	GTAC	3 cut(s)	233, 281, 380
RsaNI	GTAC	3 cut(s)	232, 280, 379
SalI	GTCGAC	1 cut(s)	172
SaqAI	TTAA	2 cut(s)	312, 670
SatI	GCNGC	1 cut(s)	57
Sau3AI	GATC	4 cut(s)	38, 115, 289, 567
Sau96I	GGNCC	2 cut(s)	10, 338
ScaI	AGTACT	1 cut(s)	233
SchI	GAGTC	1 cut(s)	219
ScrFI	CCNGG	1 cut(s)	306
SfaNI	GCATC	2 cut(s)	37, 339
SinI	GGWCC	1 cut(s)	338
Sse9I	AATT	3 cut(s)	214, 441, 633
SsiI	CCGC	8 cut(s)	5, 14, 57, 72, 87, 126, 132, 403
SspMI	CTAG	3 cut(s)	353, 540, 591
StyD4I	CCNGG	1 cut(s)	304
TaaI	ACNGT	2 cut(s)	78, 236
TaiI	ACGT	1 cut(s)	179
TaqI	TCGA	4 cut(s)	173, 273, 415, 586
TasI	AATT	3 cut(s)	214, 441, 633
TatI	WGTACW	3 cut(s)	231, 279, 378
TauI	GCSGC	1 cut(s)	59
TfiI	GAWTC	2 cut(s)	425, 560
Tru1I	TTAA	2 cut(s)	312, 670
Tru9I	TTAA	2 cut(s)	312, 670
TscAI	CASTG	1 cut(s)	351
TseFI	GTSAC	1 cut(s)	236
Tsp45I	GTSAC	1 cut(s)	236
TspDTI	ATGAA	2 cut(s)	244, 594
TspRI	CASTG	1 cut(s)	351
VpaK11BI	GGWCC	1 cut(s)	338
XmiI	GTMKAC	1 cut(s)	173
XspI	CTAG	3 cut(s)	353, 540, 591
ZrmI	AGTACT	1 cut(s)	233

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.