Rmu_sc0013544.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013544.1
Physical Location & Seq
Reverse (-)
26926 .. 27267
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013544.1_g000005.1.cds

Sequence Viewer

Length: 342 bp
atggagaagaaaaactctggtattgagttaactctcaaagaaattgcggattatggtctgaagcatgcccggacaatgaagaataccagtaactcggcttatgtttttattggaattgaaaatgagaggcctgaagcttatggttttattgttaatgaatattacacggatagtagtgatcatatcgagacatggtgggcaactggcagtggttcaaagtatgctaagccaatactccaagctaattacaacgataacttgtctgagcaacttacattgcaattggctgaagtgtctttattaacttcagcctgggggatacctacgtgtatctgtatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.69

Weight (kDa)

4.9

Isoelectric Point (pI)

34.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AcuI CTGAAG 4 cut(s) 80, 153, 291, 309
AflIII ACRYGT 1 cut(s) 326
AgsI TTSAA 2 cut(s) 119, 216
AjnI CCWGG 1 cut(s) 311
AluBI AGCT 2 cut(s) 137, 242
AluI AGCT 2 cut(s) 137, 242
Alw26I GTCTC 1 cut(s) 182
AoxI GGCC 1 cut(s) 128
AsuC2I CCSGG 1 cut(s) 70
BaeI ACNNNNGTAYC 1 cut(s) 311
BciT130I CCWGG 1 cut(s) 313
BciVI GTATCC 1 cut(s) 312
BclI TGATCA 1 cut(s) 178
BcnI CCSGG 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 182
BfuI GTATCC 1 cut(s) 312
BlpI GCTNAGC 1 cut(s) 225
Bme1390I CCNGG 2 cut(s) 70, 313
BmrFI CCNGG 2 cut(s) 70, 313
Bpu1102I GCTNAGC 1 cut(s) 225
BpuMI CCSGG 1 cut(s) 70
BsaAI YACGTR 1 cut(s) 327
BsaJI CCNNGG 1 cut(s) 312
Bse1I ACTGG 2 cut(s) 87, 208
Bse3DI GCAATG 1 cut(s) 275
BseBI CCWGG 1 cut(s) 313
BseDI CCNNGG 1 cut(s) 312
BseMI GCAATG 1 cut(s) 275
BseMII CTCAG 1 cut(s) 255
BseNI ACTGG 2 cut(s) 87, 208
BshFI GGCC 1 cut(s) 130
BsiSI CCGG 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 178
Bsp1720I GCTNAGC 1 cut(s) 225
BspACI CCGC 1 cut(s) 47
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 256
BsrDI GCAATG 1 cut(s) 275
BsrI ACTGG 2 cut(s) 87, 208
BssECI CCNNGG 1 cut(s) 312
BssMI GATC 1 cut(s) 178
Bst2UI CCWGG 1 cut(s) 313
BstBAI YACGTR 1 cut(s) 327
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 225, 264
BstKTI GATC 1 cut(s) 181
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 313
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 2 cut(s) 68, 311
BsuI GTATCC 1 cut(s) 312
BsuRI GGCC 1 cut(s) 130
BtsI GCAGTG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 214
Cac8I GCNNGC 1 cut(s) 66
CviAII CATG 2 cut(s) 65, 192
CviJI RGCY 7 cut(s) 98, 130, 137, 229, 242, 287, 311
CviKI_1 RGCY 7 cut(s) 98, 130, 137, 229, 242, 287, 311
DdeI CTNAG 2 cut(s) 225, 264
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eco147I AGGCCT 1 cut(s) 130
Eco57I CTGAAG 4 cut(s) 80, 153, 291, 309
EcoRII CCWGG 1 cut(s) 311
FaeI CATG 2 cut(s) 68, 195
FaiI YATR 7 cut(s) 54, 66, 102, 141, 183, 193, 222
FatI CATG 2 cut(s) 64, 191
FbaI TGATCA 1 cut(s) 178
HaeIII GGCC 1 cut(s) 130
HapII CCGG 1 cut(s) 70
Hin1II CATG 2 cut(s) 68, 195
HincII GTYRAC 1 cut(s) 30
HindII GTYRAC 1 cut(s) 30
HindIII AAGCTT 1 cut(s) 135
HpaI GTTAAC 1 cut(s) 30
HpaII CCGG 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 60, 265
Hpy188III TCNNGA 1 cut(s) 187
Hpy8I GTNNAC 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 326
HpyCH4V TGCA 1 cut(s) 280
HpyF3I CTNAG 2 cut(s) 225, 264
HpySE526I ACGT 1 cut(s) 326
Hsp92II CATG 2 cut(s) 68, 195
Ksp22I TGATCA 1 cut(s) 178
KspAI GTTAAC 1 cut(s) 30
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 7 cut(s) 3, 83, 100, 144, 189, 298, 325
MaeII ACGT 1 cut(s) 326
MaeIII GTNAC 1 cut(s) 89
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 2 cut(s) 19, 91
MfeI CAATTG 1 cut(s) 281
MluCI AATT 4 cut(s) 42, 114, 244, 281
MnlI CCTC 1 cut(s) 120
MseI TTAA 3 cut(s) 29, 153, 302
MspI CCGG 1 cut(s) 70
MspR9I CCNGG 2 cut(s) 70, 313
MunI CAATTG 1 cut(s) 281
MvaI CCWGG 1 cut(s) 313
NciI CCSGG 1 cut(s) 70
NdeII GATC 1 cut(s) 178
NlaIII CATG 2 cut(s) 68, 195
NmeAIII GCCGAG 1 cut(s) 74
NspI RCATGY 1 cut(s) 68
PaeI GCATGC 1 cut(s) 68
PceI AGGCCT 1 cut(s) 130
Ppu21I YACGTR 1 cut(s) 327
Psp6I CCWGG 1 cut(s) 311
PspGI CCWGG 1 cut(s) 311
SaqAI TTAA 3 cut(s) 29, 153, 302
Sau3AI GATC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 70, 313
SetI ASST 4 cut(s) 139, 244, 325, 329
SphI GCATGC 1 cut(s) 68
Sse9I AATT 4 cut(s) 42, 114, 244, 281
SseBI AGGCCT 1 cut(s) 130
SsiI CCGC 1 cut(s) 47
SspI AATATT 1 cut(s) 161
StuI AGGCCT 1 cut(s) 130
StyD4I CCNGG 2 cut(s) 68, 311
TaiI ACGT 1 cut(s) 329
TaqI TCGA 1 cut(s) 186
TasI AATT 4 cut(s) 42, 114, 244, 281
Tru1I TTAA 3 cut(s) 29, 153, 302
Tru9I TTAA 3 cut(s) 29, 153, 302
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 92, 171
TspGWI ACGGA 1 cut(s) 182
TspRI CASTG 1 cut(s) 214
XceI RCATGY 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.