Rmu_sc0013596.1_g000001

Beclin-1-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013596.1
Physical Location & Seq
Forward (+)
11 .. 1007
997 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013596.1_g000001.1.cds

Sequence Viewer

Length: 453 bp
atgggtagctaccctcggattatggacagcaacaacaatacttatgaattgtttggtccagtgaacttgttttggagcactcgttatgacaaagcaatgacactgttcttgacatgccttaaggagtttgctgagtttgcgaattccaaggaccaagaaaacaacataccacctgaaaaatgttttaaattgccctacaaaattgagaatgataaggtggaaagctattctatcactcagagcttcaataagcaggagaattggaccaaagctctcaagtacaccctctgcaatttgaaatgggctctgtattggtttgttggaaatacaaacttccagcctctttctgcacttgtgtcttcacattctgaagttccaggtgtgagctctttgtacacaagacgtggtaacgactccaagttggagttccgaaactcatcacccatgacatag

Protein Analysis

150

Amino Acids

17.45

Weight (kDa)

8.38

Isoelectric Point (pI)

33.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 142
AcuI CTGAAG 1 cut(s) 390
AfaI GTAC 2 cut(s) 281, 395
AflII CTTAAG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 247, 298
AjiI CACGTC 1 cut(s) 404
AjnI CCWGG 1 cut(s) 376
AjuI GAANNNNNNNTTGG 2 cut(s) 410, 442
AluBI AGCT 5 cut(s) 9, 225, 243, 272, 387
AluI AGCT 5 cut(s) 9, 225, 243, 272, 387
Alw21I GWGCWC 2 cut(s) 80, 389
ApoI RAATTY 1 cut(s) 142
AspS9I GGNCC 3 cut(s) 56, 151, 264
AsuHPI GGTGA 1 cut(s) 432
AvaII GGWCC 3 cut(s) 56, 151, 264
BanII GRGCYC 2 cut(s) 307, 389
BbsI GAAGAC 1 cut(s) 351
Bbv12I GWGCWC 2 cut(s) 80, 389
BciT130I CCWGG 1 cut(s) 378
BfrI CTTAAG 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 378
Bme18I GGWCC 3 cut(s) 56, 151, 264
BmgBI CACGTC 1 cut(s) 404
BmgT120I GGNCC 3 cut(s) 56, 151, 264
BmrFI CCNGG 1 cut(s) 378
BpiI GAAGAC 1 cut(s) 351
BpuEI CTTGAG 1 cut(s) 260
BsaJI CCNNGG 2 cut(s) 14, 147
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bse1I ACTGG 1 cut(s) 59
Bse3DI GCAATG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 378
BseDI CCNNGG 2 cut(s) 14, 147
BseMI GCAATG 1 cut(s) 102
BseMII CTCAG 2 cut(s) 123, 251
BseNI ACTGG 1 cut(s) 59
BsgI GTGCAG 1 cut(s) 333
BsiHKAI GWGCWC 2 cut(s) 80, 389
Bsp1286I GDGCHC 3 cut(s) 80, 307, 389
Bsp1407I TGTACA 1 cut(s) 393
BspCNI CTCAG 2 cut(s) 124, 250
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 102
BsrGI TGTACA 1 cut(s) 393
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 2 cut(s) 14, 147
BssT1I CCWWGG 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 378
Bst4CI ACNGT 1 cut(s) 105
BstAFI CTTAAG 1 cut(s) 119
BstAUI TGTACA 1 cut(s) 393
BstDEI CTNAG 2 cut(s) 132, 237
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 378
BstNSI RCATGY 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 376
BstV2I GAAGAC 1 cut(s) 351
BtrI CACGTC 1 cut(s) 404
BtsIMutI CAGTG 2 cut(s) 66, 101
Cfr13I GGNCC 3 cut(s) 56, 151, 264
Csp6I GTAC 2 cut(s) 280, 394
CviAII CATG 2 cut(s) 114, 445
CviJI RGCY 7 cut(s) 9, 225, 243, 272, 305, 340, 387
CviKI_1 RGCY 7 cut(s) 9, 225, 243, 272, 305, 340, 387
CviQI GTAC 2 cut(s) 280, 394
DdeI CTNAG 2 cut(s) 132, 237
DraI TTTAAA 1 cut(s) 187
Ecl136II GAGCTC 1 cut(s) 387
Eco130I CCWWGG 1 cut(s) 147
Eco24I GRGCYC 2 cut(s) 307, 389
Eco47I GGWCC 3 cut(s) 56, 151, 264
Eco53kI GAGCTC 1 cut(s) 387
Eco57I CTGAAG 1 cut(s) 390
EcoICRI GAGCTC 1 cut(s) 387
EcoRI GAATTC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 376
EcoT14I CCWWGG 1 cut(s) 147
EcoT38I GRGCYC 2 cut(s) 307, 389
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 2 cut(s) 117, 448
FaiI YATR 7 cut(s) 23, 45, 87, 115, 167, 446, 451
FatI CATG 2 cut(s) 113, 444
FriOI GRGCYC 2 cut(s) 307, 389
Hin1II CATG 2 cut(s) 117, 448
HinfI GANTC 1 cut(s) 413
HphI GGTGA 1 cut(s) 432
Hpy166II GTNNAC 3 cut(s) 64, 282, 396
Hpy188I TCNGA 4 cut(s) 18, 240, 370, 431
Hpy188III TCNNGA 1 cut(s) 109
Hpy8I GTNNAC 3 cut(s) 64, 282, 396
HpyCH4III ACNGT 1 cut(s) 105
HpyCH4IV ACGT 1 cut(s) 403
HpyCH4V TGCA 2 cut(s) 291, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
HpyF3I CTNAG 2 cut(s) 132, 237
HpySE526I ACGT 1 cut(s) 403
Hsp92II CATG 2 cut(s) 117, 448
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 6 cut(s) 72, 186, 239, 350, 363, 390
MaeII ACGT 1 cut(s) 403
MaeIII GTNAC 1 cut(s) 407
MboII GAAGA 1 cut(s) 351
MhlI GDGCHC 3 cut(s) 80, 307, 389
MluCI AATT 6 cut(s) 47, 142, 188, 201, 259, 292
MlyI GAGTC 1 cut(s) 407
MmeI TCCRAC 2 cut(s) 301, 402
MnlI CCTC 3 cut(s) 24, 296, 351
MseI TTAA 2 cut(s) 120, 186
MspCI CTTAAG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 378
MvaI CCWGG 1 cut(s) 378
MwoI GCNNNNNNNGC 1 cut(s) 137
NlaIII CATG 2 cut(s) 117, 448
NspI RCATGY 1 cut(s) 117
PleI GAGTC 1 cut(s) 407
PpsI GAGTC 1 cut(s) 407
Psp124BI GAGCTC 1 cut(s) 389
Psp6I CCWGG 1 cut(s) 376
PspGI CCWGG 1 cut(s) 376
PspPI GGNCC 3 cut(s) 56, 151, 264
RsaI GTAC 2 cut(s) 281, 395
RsaNI GTAC 2 cut(s) 280, 394
SacI GAGCTC 1 cut(s) 389
SaqAI TTAA 2 cut(s) 120, 186
Sau96I GGNCC 3 cut(s) 56, 151, 264
SchI GAGTC 1 cut(s) 407
ScrFI CCNGG 1 cut(s) 378
SduI GDGCHC 3 cut(s) 80, 307, 389
SetI ASST 9 cut(s) 11, 175, 219, 227, 245, 274, 382, 389, 406
SinI GGWCC 3 cut(s) 56, 151, 264
SmlI CTYRAG 2 cut(s) 119, 275
SmoI CTYRAG 2 cut(s) 119, 275
Sse9I AATT 6 cut(s) 47, 142, 188, 201, 259, 292
SstI GAGCTC 1 cut(s) 389
StyD4I CCNGG 1 cut(s) 376
StyI CCWWGG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 105
TaiI ACGT 1 cut(s) 406
TasI AATT 6 cut(s) 47, 142, 188, 201, 259, 292
TatI WGTACW 2 cut(s) 279, 393
Tru1I TTAA 2 cut(s) 120, 186
Tru9I TTAA 2 cut(s) 120, 186
TscAI CASTG 2 cut(s) 66, 108
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 2 cut(s) 66, 108
Vha464I CTTAAG 1 cut(s) 119
VpaK11BI GGWCC 3 cut(s) 56, 151, 264
XapI RAATTY 1 cut(s) 142
XceI RCATGY 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.