Rmu_sc0017222.1_g000001

Beclin-1-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017222.1
Physical Location & Seq
Forward (+)
1 .. 551
551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017222.1_g000001.1.cds

Sequence Viewer

Length: 253 bp
aattgagaatgataaggtggaaagctattctatcactcagagcttcaataagcaggagaattggaccaaagctctcaagtacaccctctgcaatttgaaatgggctctgtattggtttgttggaaatacaaacttccagcctctttctgcacttgtgtcttcacattctgaagttccaggtgtgagctctttgtacacaagacgtggtaacgactccaagttggagttccgaaactcatcacccatgacatag

Protein Analysis

83

Amino Acids

9.55

Weight (kDa)

8.83

Isoelectric Point (pI)

36.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 190
AfaI GTAC 2 cut(s) 81, 195
AgsI TTSAA 2 cut(s) 47, 98
AjiI CACGTC 1 cut(s) 204
AjnI CCWGG 1 cut(s) 176
AjuI GAANNNNNNNTTGG 2 cut(s) 210, 242
AluBI AGCT 4 cut(s) 25, 43, 72, 187
AluI AGCT 4 cut(s) 25, 43, 72, 187
Alw21I GWGCWC 1 cut(s) 189
AspS9I GGNCC 1 cut(s) 64
AsuHPI GGTGA 1 cut(s) 232
AvaII GGWCC 1 cut(s) 64
BanII GRGCYC 2 cut(s) 107, 189
BbsI GAAGAC 1 cut(s) 151
Bbv12I GWGCWC 1 cut(s) 189
BciT130I CCWGG 1 cut(s) 178
Bme1390I CCNGG 1 cut(s) 178
Bme18I GGWCC 1 cut(s) 64
BmgBI CACGTC 1 cut(s) 204
BmgT120I GGNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 178
BpiI GAAGAC 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 178
BseMII CTCAG 1 cut(s) 51
BsgI GTGCAG 1 cut(s) 133
BsiHKAI GWGCWC 1 cut(s) 189
Bsp1286I GDGCHC 2 cut(s) 107, 189
Bsp1407I TGTACA 1 cut(s) 193
BspCNI CTCAG 1 cut(s) 50
BsrGI TGTACA 1 cut(s) 193
Bst2UI CCWGG 1 cut(s) 178
BstAUI TGTACA 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 37
BstNI CCWGG 1 cut(s) 178
BstSCI CCNGG 1 cut(s) 176
BstV2I GAAGAC 1 cut(s) 151
BtrI CACGTC 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 64
Csp6I GTAC 2 cut(s) 80, 194
CviAII CATG 1 cut(s) 245
CviJI RGCY 6 cut(s) 25, 43, 72, 105, 140, 187
CviKI_1 RGCY 6 cut(s) 25, 43, 72, 105, 140, 187
CviQI GTAC 2 cut(s) 80, 194
DdeI CTNAG 1 cut(s) 37
Ecl136II GAGCTC 1 cut(s) 187
Eco24I GRGCYC 2 cut(s) 107, 189
Eco47I GGWCC 1 cut(s) 64
Eco53kI GAGCTC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 190
EcoICRI GAGCTC 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 176
EcoT38I GRGCYC 2 cut(s) 107, 189
FaeI CATG 1 cut(s) 248
FaiI YATR 2 cut(s) 246, 251
FatI CATG 1 cut(s) 244
FriOI GRGCYC 2 cut(s) 107, 189
Hin1II CATG 1 cut(s) 248
HinfI GANTC 1 cut(s) 213
HphI GGTGA 1 cut(s) 232
Hpy166II GTNNAC 2 cut(s) 82, 196
Hpy188I TCNGA 3 cut(s) 40, 170, 231
Hpy8I GTNNAC 2 cut(s) 82, 196
HpyCH4IV ACGT 1 cut(s) 203
HpyCH4V TGCA 2 cut(s) 91, 150
HpyF3I CTNAG 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 203
Hsp92II CATG 1 cut(s) 248
LpnPI CCDG 4 cut(s) 39, 150, 163, 190
MaeII ACGT 1 cut(s) 203
MaeIII GTNAC 1 cut(s) 207
MboII GAAGA 1 cut(s) 151
MhlI GDGCHC 2 cut(s) 107, 189
MluCI AATT 2 cut(s) 59, 92
MlyI GAGTC 1 cut(s) 207
MmeI TCCRAC 2 cut(s) 101, 202
MnlI CCTC 2 cut(s) 96, 151
MspR9I CCNGG 1 cut(s) 178
MvaI CCWGG 1 cut(s) 178
NlaIII CATG 1 cut(s) 248
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
Psp124BI GAGCTC 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 176
PspGI CCWGG 1 cut(s) 176
PspPI GGNCC 1 cut(s) 64
RsaI GTAC 2 cut(s) 81, 195
RsaNI GTAC 2 cut(s) 80, 194
SacI GAGCTC 1 cut(s) 189
Sau96I GGNCC 1 cut(s) 64
SchI GAGTC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 178
SduI GDGCHC 2 cut(s) 107, 189
SetI ASST 7 cut(s) 19, 27, 45, 74, 182, 189, 206
SgeI CNNG 9 cut(s) 66, 89, 149, 165, 189, 190, 211, 216, 230
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 2 cut(s) 59, 92
SstI GAGCTC 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 176
TaiI ACGT 1 cut(s) 206
TasI AATT 2 cut(s) 59, 92
TatI WGTACW 2 cut(s) 79, 193
VpaK11BI GGWCC 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.