Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013667.1

Orthogroup ID

OG0006548

Physical Location & Seq

Genomic Coordinates Reverse (-)

10683 .. 13972

Gene Structure 3290 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013667.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 990 bp

atgagtatgacccagttcgctatggttgaggaattggcttctcttgtcaaggacaatctttcgtgcaagcatctcattctctcagtggaagaggctttggtggatttccttcagagtgataccagttccagtggagtcttgcagttggaaccaatgaactcatacaaccgtcttctcttgcatcgtcttgcagatatatttggattttcccatgaatctgttggtgaaggagaggagcggcatttagttttggagcgatgcccggagacatcaataccgtccatccttgtcagtgatattttgtggcagtatgatgagcctgaatctccaatgacttcacacttattattaaagaggtcagaagcccctccagtgttaaggaaaaaatctcctccgcttcaacattcactagaggagagagaagcagcatatttggcagctcgtgagcgaatattttcgagggatttgggagaagtaaaggaatctgtcactcagaggcaacgcaatgttcctgtggttgcccgtcggatgatagcgcatgccctaggcaaaagaatcaacccatccagtcaggatgccactcatgaggattgcaacgcatctagagggctgagtgataagttgaattgtcaaggcaaggttgaagttgagaccaatttgattgtggaagcttgtcatcagaccctcacccctttggaccaaaatgtgaactcctgtggtgaagtgaaaaagaacaaccgtagtttgaatgcatcacccccaagtctaagtgaaaggaagacatcccaaaaacaagatgacaagatttctggtgctgtcagcagcatatctcaaaacggaagaaaaggacatggtgcagatgaggaagacatcaaaagggaacatttgggtgcagcaaagaggatgtttgctcatgccctaggaatgcgctcagggaagaatggtgtttcatcaaaaggcagcgagataaagcatgttaacatggagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

R3H SUZ

Protein Analysis

329

Amino Acids

36.48

Weight (kDa)

6.37

Isoelectric Point (pI)

52.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006548)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g00730
malus_domestica	MD04G1241800.v1.1 MD12G1258600.v1.1
prunus_persica	Prupe.6G359200_v2.0.a1 Prupe.6G359200_v2.0.a1 Prupe.6G359200_v2.0.a1 Prupe.6G359200_v2.0.a1 Prupe.6G359200_v2.0.a1 Prupe.6G359200_v2.0.a1
pyrus_communis	pycom04g21330 pycom12g23720
rosa_chinensis	RchiOBHm_Chr3g0448201
rosa_laevigata	RLG00000025938 RLG00000026018
rosa_multiflora	Rmu_sc0005969.1_g000035 Rmu_sc0013667.1_g000003
rosa_roxburghii	Rroxscaffold_6G00426340
rosa_rugosa	Rorug02G0608500 Rorug02G0608600 Rorug02G0608700 Rorug02G0608700
rosa_samantha	Rh3AG008800 Rh3BG008300 Rh3CG008400 Rh3DG009000
rosa_wichuraiana	Rw3G000700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	238
AciI	CCGC	2 cut(s)	238, 395
AcuI	CTGAAG	1 cut(s)	95
AgsI	TTSAA	4 cut(s)	401, 625, 644, 748
AluBI	AGCT	2 cut(s)	440, 671
AluI	AGCT	2 cut(s)	440, 671
Alw26I	GTCTC	2 cut(s)	260, 644
ApeKI	GCWGC	5 cut(s)	425, 437, 822, 893, 960
Asp700I	GAANNNNTTC	1 cut(s)	454
AspA2I	CCTAGG	2 cut(s)	544, 919
AspLEI	GCGC	2 cut(s)	538, 930
AspS9I	GGNCC	1 cut(s)	697
AsuC2I	CCSGG	1 cut(s)	263
AsuHPI	GGTGA	4 cut(s)	236, 679, 731, 747
AvaII	GGWCC	1 cut(s)	697
AvrII	CCTAGG	2 cut(s)	544, 919
BauI	CACGAG	1 cut(s)	441
BbsI	GAAGAC	3 cut(s)	164, 785, 873
BbvI	GCAGC	5 cut(s)	437, 449, 834, 905, 972
BccI	CCATC	2 cut(s)	290, 571
BcnI	CCSGG	1 cut(s)	263
BcoDI	GTCTC	2 cut(s)	260, 644
BfaI	CTAG	4 cut(s)	410, 545, 603, 920
BisI	GCNGC	6 cut(s)	239, 426, 438, 823, 894, 961
BlnI	CCTAGG	2 cut(s)	544, 919
BlsI	GCNGC	6 cut(s)	240, 427, 439, 824, 895, 962
Bme1390I	CCNGG	1 cut(s)	263
Bme18I	GGWCC	1 cut(s)	697
BmgT120I	GGNCC	1 cut(s)	697
BmiI	GGNNCC	1 cut(s)	150
BmrFI	CCNGG	1 cut(s)	263
BmrI	ACTGGG	1 cut(s)	7
BmsI	GCATC	6 cut(s)	79, 190, 248, 565, 608, 761
BmuI	ACTGGG	1 cut(s)	7
BpiI	GAAGAC	3 cut(s)	164, 785, 873
BpmI	CTGGAG	1 cut(s)	354
Bpu10I	CCTNAGC	1 cut(s)	931
BpuMI	CCSGG	1 cut(s)	263
BsaI	GGTCTC	1 cut(s)	644
BsaJI	CCNNGG	2 cut(s)	544, 919
Bse1I	ACTGG	5 cut(s)	13, 123, 129, 371, 567
Bse3DI	GCAATG	1 cut(s)	511
BseDI	CCNNGG	2 cut(s)	544, 919
BseGI	GGATG	6 cut(s)	282, 534, 563, 580, 782, 909
BseMI	GCAATG	1 cut(s)	511
BseMII	CTCAG	4 cut(s)	96, 506, 602, 945
BseNI	ACTGG	5 cut(s)	13, 123, 129, 371, 567
BseRI	GAGGAG	3 cut(s)	248, 381, 428
BseXI	GCAGC	5 cut(s)	437, 449, 834, 905, 972
BsgI	GTGCAG	2 cut(s)	876, 912
BsiSI	CCGG	1 cut(s)	263
BsmAI	GTCTC	2 cut(s)	260, 644
BsmI	GAATGC	2 cut(s)	754, 930
Bso31I	GGTCTC	1 cut(s)	644
BspACI	CCGC	2 cut(s)	238, 395
BspCNI	CTCAG	4 cut(s)	95, 505, 603, 944
BspHI	TCATGA	1 cut(s)	583
BspLI	GGNNCC	1 cut(s)	150
BspTNI	GGTCTC	1 cut(s)	644
BsrBI	CCGCTC	1 cut(s)	238
BsrDI	GCAATG	1 cut(s)	511
BsrI	ACTGG	5 cut(s)	13, 123, 129, 371, 567
BssECI	CCNNGG	2 cut(s)	544, 919
BssSI	CACGAG	1 cut(s)	441
BssT1I	CCWWGG	2 cut(s)	544, 919
Bst2BI	CACGAG	1 cut(s)	441
Bst4CI	ACNGT	3 cut(s)	170, 279, 740
Bst6I	CTCTTC	1 cut(s)	84
BstC8I	GCNNGC	2 cut(s)	68, 540
BstDEI	CTNAG	5 cut(s)	82, 492, 611, 767, 931
BstF5I	GGATG	6 cut(s)	282, 534, 563, 580, 782, 909
BstHHI	GCGC	2 cut(s)	538, 930
BstMAI	GTCTC	2 cut(s)	260, 644
BstMWI	GCNNNNNNNGC	1 cut(s)	434
BstNSI	RCATGY	2 cut(s)	542, 977
BstSCI	CCNGG	1 cut(s)	261
BstV1I	GCAGC	5 cut(s)	437, 449, 834, 905, 972
BstV2I	GAAGAC	3 cut(s)	164, 785, 873
BtgZI	GCGATG	1 cut(s)	271
BtsCI	GGATG	6 cut(s)	282, 534, 563, 580, 782, 909
BtsIMutI	CAGTG	4 cut(s)	90, 136, 298, 378
Cac8I	GCNNGC	2 cut(s)	68, 540
CciI	TCATGA	1 cut(s)	583
CfoI	GCGC	2 cut(s)	538, 930
Cfr13I	GGNCC	1 cut(s)	697
CviAII	CATG	7 cut(s)	212, 539, 584, 851, 914, 974, 982
CviJI	RGCY	7 cut(s)	38, 95, 319, 365, 440, 610, 671
CviKI_1	RGCY	7 cut(s)	38, 95, 319, 365, 440, 610, 671
DdeI	CTNAG	5 cut(s)	82, 492, 611, 767, 931
Eam1104I	CTCTTC	1 cut(s)	84
EarI	CTCTTC	1 cut(s)	84
Eco130I	CCWWGG	2 cut(s)	544, 919
Eco31I	GGTCTC	1 cut(s)	644
Eco47I	GGWCC	1 cut(s)	697
Eco57I	CTGAAG	1 cut(s)	95
EcoT14I	CCWWGG	2 cut(s)	544, 919
EcoT22I	ATGCAT	1 cut(s)	754
ErhI	CCWWGG	2 cut(s)	544, 919
FaeI	CATG	7 cut(s)	215, 542, 587, 854, 917, 977, 985
FatI	CATG	7 cut(s)	211, 538, 583, 850, 913, 973, 981
Fnu4HI	GCNGC	6 cut(s)	239, 426, 438, 823, 894, 961
FokI	GGATG	6 cut(s)	269, 541, 550, 587, 769, 916
Fsp4HI	GCNGC	6 cut(s)	239, 426, 438, 823, 894, 961
FspBI	CTAG	4 cut(s)	410, 545, 603, 920
GlaI	GCGC	2 cut(s)	537, 929
GluI	GCNGC	6 cut(s)	239, 426, 438, 823, 894, 961
GsuI	CTGGAG	1 cut(s)	354
HapII	CCGG	1 cut(s)	263
HhaI	GCGC	2 cut(s)	538, 930
Hin1II	CATG	7 cut(s)	215, 542, 587, 854, 917, 977, 985
Hin6I	GCGC	2 cut(s)	536, 928
HinP1I	GCGC	2 cut(s)	536, 928
HincII	GTYRAC	1 cut(s)	979
HindII	GTYRAC	1 cut(s)	979
HindIII	AAGCTT	1 cut(s)	669
HinfI	GANTC	5 cut(s)	135, 215, 323, 482, 555
HpaI	GTTAAC	1 cut(s)	979
HpaII	CCGG	1 cut(s)	263
HphI	GGTGA	4 cut(s)	236, 679, 731, 747
Hpy166II	GTNNAC	2 cut(s)	709, 979
Hpy188I	TCNGA	5 cut(s)	114, 361, 495, 528, 681
Hpy188III	TCNNGA	4 cut(s)	443, 572, 584, 603
Hpy8I	GTNNAC	2 cut(s)	709, 979
Hpy99I	CGWCG	1 cut(s)	528
HpyAV	CCTTC	2 cut(s)	119, 221
HpyCH4III	ACNGT	3 cut(s)	170, 279, 740
HpyCH4V	TGCA	8 cut(s)	66, 142, 181, 191, 594, 752, 857, 893
HpyF10VI	GCNNNNNNNGC	1 cut(s)	434
HpyF3I	CTNAG	5 cut(s)	82, 492, 611, 767, 931
Hsp92II	CATG	7 cut(s)	215, 542, 587, 854, 917, 977, 985
HspAI	GCGC	2 cut(s)	536, 928
KspAI	GTTAAC	1 cut(s)	979
LmnI	GCTCC	2 cut(s)	235, 253
Lsp1109I	GCAGC	5 cut(s)	437, 449, 834, 905, 972
LweI	GCATC	6 cut(s)	79, 190, 248, 565, 608, 761
MaeI	CTAG	4 cut(s)	410, 545, 603, 920
MaeIII	GTNAC	1 cut(s)	487
MbiI	CCGCTC	1 cut(s)	238
MboII	GAAGA	6 cut(s)	101, 164, 790, 852, 878, 949
MluCI	AATT	3 cut(s)	32, 625, 655
MlyI	GAGTC	1 cut(s)	144
MmeI	TCCRAC	2 cut(s)	126, 506
Mph1103I	ATGCAT	1 cut(s)	754
MroXI	GAANNNNTTC	1 cut(s)	454
MseI	TTAA	3 cut(s)	350, 377, 978
MslI	CAYNNNNRTG	1 cut(s)	888
MspI	CCGG	1 cut(s)	263
MspR9I	CCNGG	1 cut(s)	263
Mva1269I	GAATGC	2 cut(s)	754, 930
MwoI	GCNNNNNNNGC	1 cut(s)	434
NciI	CCSGG	1 cut(s)	263
NlaIII	CATG	7 cut(s)	215, 542, 587, 854, 917, 977, 985
NlaIV	GGNNCC	1 cut(s)	150
NmuCI	GTSAC	1 cut(s)	487
NsiI	ATGCAT	1 cut(s)	754
NspI	RCATGY	2 cut(s)	542, 977
PaeI	GCATGC	1 cut(s)	542
PagI	TCATGA	1 cut(s)	583
PctI	GAATGC	2 cut(s)	754, 930
PdmI	GAANNNNTTC	1 cut(s)	454
PfeI	GAWTC	4 cut(s)	215, 323, 482, 555
PkrI	GCNGC	6 cut(s)	240, 427, 439, 824, 895, 962
PleI	GAGTC	1 cut(s)	143
PpsI	GAGTC	1 cut(s)	143
PspN4I	GGNNCC	1 cut(s)	150
PspPI	GGNCC	1 cut(s)	697
RseI	CAYNNNNRTG	1 cut(s)	888
SaqAI	TTAA	3 cut(s)	350, 377, 978
SatI	GCNGC	6 cut(s)	239, 426, 438, 823, 894, 961
Sau96I	GGNCC	1 cut(s)	697
SchI	GAGTC	1 cut(s)	144
ScrFI	CCNGG	1 cut(s)	263
SetI	ASST	4 cut(s)	359, 442, 642, 673
SfaNI	GCATC	6 cut(s)	79, 190, 248, 565, 608, 761
SinI	GGWCC	1 cut(s)	697
SmiMI	CAYNNNNRTG	1 cut(s)	888
SphI	GCATGC	1 cut(s)	542
Sse9I	AATT	3 cut(s)	32, 625, 655
SsiI	CCGC	2 cut(s)	238, 395
SspI	AATATT	1 cut(s)	453
SspMI	CTAG	4 cut(s)	410, 545, 603, 920
StyD4I	CCNGG	1 cut(s)	261
StyI	CCWWGG	2 cut(s)	544, 919
TaaI	ACNGT	3 cut(s)	170, 279, 740
TaqI	TCGA	1 cut(s)	458
TasI	AATT	3 cut(s)	32, 625, 655
TauI	GCSGC	1 cut(s)	241
TfiI	GAWTC	4 cut(s)	215, 323, 482, 555
Tru1I	TTAA	3 cut(s)	350, 377, 978
Tru9I	TTAA	3 cut(s)	350, 377, 978
TscAI	CASTG	4 cut(s)	90, 136, 298, 378
TseFI	GTSAC	1 cut(s)	487
TseI	GCWGC	5 cut(s)	425, 437, 822, 893, 960
Tsp45I	GTSAC	1 cut(s)	487
TspDTI	ATGAA	3 cut(s)	170, 228, 939
TspGWI	ACGGA	1 cut(s)	852
TspRI	CASTG	4 cut(s)	90, 136, 298, 378
VpaK11BI	GGWCC	1 cut(s)	697
XbaI	TCTAGA	1 cut(s)	602
XceI	RCATGY	2 cut(s)	542, 977
XcmI	CCANNNNNNNNNTGG	2 cut(s)	218, 661
XmaJI	CCTAGG	2 cut(s)	544, 919
XmnI	GAANNNNTTC	1 cut(s)	454
XspI	CTAG	4 cut(s)	410, 545, 603, 920
Zsp2I	ATGCAT	1 cut(s)	754

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.