Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013945.1

Orthogroup ID

OG0006600

Physical Location & Seq

Genomic Coordinates Forward (+)

40986 .. 43160

Gene Structure 2175 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013945.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2175 bp

atgccatcatcttatcctcatttcatcccaaaggaactttttgcatcccaaatccagagattcatacctaagacatggaaagaaggtatcaaacagctcgagaaaccatcatctattttagagccgagtttaccagttggtgattctatgatagattctcttcttgcatccattaagacttatgcacgtgaaggacatctatcagaagcattcaaaagcctgtctcttattaagctccatgcctcttctagtacatcttgtgatgcagtcttacattccatctcttctcttcttttctcgtgcaccaaccataaatcattcccacagggtaaacagcttcacgcacacattatcagattgggtcttgaacaacaccccgttttggtccccaagcttgtcacattttattcgagctttaattcccatattgatgctcatattgttgttgagaattccaatatattgcatcctctaccttggaatttgctcatctcttcatatgttaaaaatgaacttctggatgaggctctcactacctatgaacatatggtcaataaggggattagaccggattgtttcacttatccatctgttctcaaggcttgtggtgagaagttggatataggttttgggaaggaggtgcataagtccattgatgctagttggcaggagtggaatttgtttgtgcataattcattggtctccatgtatggaaagtttgggcttgtggatgttgctcgtcagttgtttgacataatgccccaaagggatataatttcttggaattcaatgatctcgtgttatgcctccaaaggtatgtggaatgaagcatttgagctgtttggaaaattgcagatggagggtactgaagtaagtattataacttggaataccatagctggaggttgcttgagaacaggaaatataaagggtgctctggagttgctttctcaaatgagagttggtggtattcaactggactcagtggcatttacggttgggcttagtgcttcttcccacattggatctattaagttagggaaggagatgcatggttctgcaattcgtacttgttgtgatgggtatgacaatgtcagaaatgcattaattacaatgtattccaggtgcaaagatctaagtcatgcctatactttgtttcaatcgatagaagataggagtatagtcacttggaactccatgatttctggttattcccacatggatcgagcagaggaagcttcattcatatttagagagatgttgtgttctggaattgaacccaattacgttacgattgccagcatcctgcctctttgtgctcgggtagcaaatcttcaacatggaaaggaatttcactgctacattacaaaacgtgttgtgtttgatgattatttattgctgtggaatgctcttgtggacatgtatgccagatcaggcagggttatagaagctaaaagagtatttgattcaatgaataagaaggatgaggttacttatacttccatgattgcaggatatggagtacagggtgagggaaaagctgcattgaagttatttgaagagatgaatagtttaaacatccaaccagatcatgtaaccatggtttccattttatcagcatgtagccattcaggacttgtaatccaaggccaaattctattcgaaaggatggtgagtatgtatggtataactcccgatttggagcactatgcttgcatggttgatctctatgggagggctggtctattacataatgcaaaagatattatcaaaaggatgccttacaagccaacttctgccatgtgggccactctgattggagcttgtaggatccatggaaatacagagataggggaatgggcagctgagatgctattacaaatgagacctgagaattctgggtactatgtcttaattgctaacatgtatgctgctgctggtagttggaacaacctagctagagtgaggactttcatgagggacttgggtgtaaggaaggctcctggatgcgcttgggttgacgtgggtgatggattctccctctttttggtgggggacaccacaaatcagctgagaaatgaaatttaccttttgttggatggattaaatgagctgatgaaagatgctgattatattagagaggattttagttcaggttatgaagtttttgagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

724

Amino Acids

81.16

Weight (kDa)

6.21

Isoelectric Point (pI)

41.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006600)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G22830 AT1G22830 AT1G71490
fragaria_vesca	FvH4_5g32370
malus_domestica	MD04G1056500.v1.1 MD15G1404200.v1.1
prunus_persica	Prupe.1G551000_v2.0.a1 Prupe.1G551000_v2.0.a1 Prupe.1G551000_v2.0.a1
pyrus_communis	pycom04g04960 pycom15g36160
rosa_chinensis	RchiOBHm_Chr7g0228861
rosa_laevigata	RLG00000001540 RLG00000002151 RLG00000002152
rosa_multiflora	Rmu_co8395259.1_g000001 Rmu_sc0004517.1_g000002 Rmu_sc0011218.1_g000005 Rmu_sc0013945.1_g000009
rosa_rugosa	Rorug07G0252400 Rorug07G0252500
rosa_samantha	Rh7AG405700 Rh7BG385000 Rh7CG423300 Rh7DG399700
rosa_wichuraiana	Rw7G033610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	881
AclWI	GGATC	4 cut(s)	1033, 1230, 1825, 1838
AcsI	RAATTY	8 cut(s)	451, 481, 676, 784, 1349, 1653, 1894, 2082
AcuI	CTGAAG	1 cut(s)	888
AcvI	CACGTG	1 cut(s)	188
AfaI	GTAC	5 cut(s)	253, 865, 1069, 1524, 1904
AfiI	CCNNNNNNNGG	3 cut(s)	382, 2047, 2095
AflIII	ACRYGT	3 cut(s)	1372, 1419, 1923
AjiI	CACGTC	1 cut(s)	2023
AjnI	CCWGG	2 cut(s)	1121, 2002
AjuI	GAANNNNNNNTTGG	2 cut(s)	1638, 1670
Alw21I	GWGCWC	4 cut(s)	305, 937, 1321, 1707
Alw26I	GTCTC	3 cut(s)	228, 706, 1879
Alw44I	GTGCAC	1 cut(s)	301
AlwI	GGATC	4 cut(s)	1033, 1230, 1825, 1838
Ama87I	CYCGRG	2 cut(s)	98, 1320
AoxI	GGCC	2 cut(s)	1648, 1806
ApaLI	GTGCAC	1 cut(s)	301
ApeKI	GCWGC	4 cut(s)	1541, 1862, 1931, 1934
ApoI	RAATTY	8 cut(s)	451, 481, 676, 784, 1349, 1653, 1894, 2082
AseI	ATTAAT	1 cut(s)	1106
AspLEI	GCGC	1 cut(s)	2012
AspS9I	GGNCC	2 cut(s)	385, 1806
AsuHPI	GGTGA	5 cut(s)	152, 620, 1541, 1684, 2039
AsuII	TTCGAA	1 cut(s)	1662
AvaI	CYCGRG	2 cut(s)	98, 1320
AvaII	GGWCC	1 cut(s)	385
BaeGI	GKGCMC	1 cut(s)	305
BaeI	ACNNNNGTAYC	2 cut(s)	855, 888
BamHI	GGATCC	1 cut(s)	1830
BarI	GAAGNNNNNNTAC	2 cut(s)	1317, 1349
BauI	CACGAG	2 cut(s)	298, 796
BbrPI	CACGTG	1 cut(s)	188
Bbv12I	GWGCWC	4 cut(s)	305, 937, 1321, 1707
BbvI	GCAGC	4 cut(s)	1528, 1874, 1918, 1921
BccI	CCATC	9 cut(s)	13, 115, 287, 595, 850, 1073, 1663, 2024, 2093
BciT130I	CCWGG	2 cut(s)	1123, 2004
BcoDI	GTCTC	3 cut(s)	228, 706, 1879
BfaI	CTAG	4 cut(s)	249, 660, 1955, 1959
BglI	GCCNNNNNGGC	1 cut(s)	1805
BglII	AGATCT	1 cut(s)	1132
BisI	GCNGC	4 cut(s)	1542, 1863, 1932, 1935
BlsI	GCNGC	4 cut(s)	1543, 1864, 1933, 1936
Bme1390I	CCNGG	2 cut(s)	1123, 2004
Bme18I	GGWCC	1 cut(s)	385
BmeT110I	CYCGRG	2 cut(s)	98, 1320
BmgBI	CACGTC	1 cut(s)	2023
BmgT120I	GGNCC	2 cut(s)	385, 1806
BmiI	GGNNCC	3 cut(s)	387, 1832, 2001
BmrFI	CCNGG	2 cut(s)	1123, 2004
BpmI	CTGGAG	2 cut(s)	921, 959
Bpu14I	TTCGAA	1 cut(s)	1662
BpuEI	CTTGAG	2 cut(s)	581, 931
Bsa29I	ATCGAT	1 cut(s)	1163
BsaAI	YACGTR	1 cut(s)	188
BsaI	GGTCTC	2 cut(s)	706, 1879
BsaJI	CCNNGG	4 cut(s)	476, 1599, 1645, 1834
BsaWI	WCCGGW	1 cut(s)	568
BsaXI	ACNNNNNCTCC	2 cut(s)	1726, 1756
Bsc4I	CCNNNNNNNGG	3 cut(s)	382, 2047, 2095
Bse1I	ACTGG	2 cut(s)	134, 981
BseBI	CCWGG	2 cut(s)	1123, 2004
BseCI	ATCGAT	1 cut(s)	1163
BseDI	CCNNGG	4 cut(s)	476, 1599, 1645, 1834
BseLI	CCNNNNNNNGG	3 cut(s)	382, 2047, 2095
BseMII	CTCAG	4 cut(s)	996, 1857, 1881, 2063
BseNI	ACTGG	2 cut(s)	134, 981
BseSI	GKGCMC	1 cut(s)	305
BseXI	GCAGC	4 cut(s)	1528, 1874, 1918, 1921
BshFI	GGCC	2 cut(s)	1650, 1808
BshVI	ATCGAT	1 cut(s)	1163
BsiHKAI	GWGCWC	4 cut(s)	305, 937, 1321, 1707
BsiHKCI	CYCGRG	2 cut(s)	98, 1320
BsiSI	CCGG	1 cut(s)	569
BslFI	GGGAC	3 cut(s)	371, 1994, 2069
BslI	CCNNNNNNNGG	3 cut(s)	382, 2047, 2095
BsmAI	GTCTC	3 cut(s)	228, 706, 1879
BsmFI	GGGAC	3 cut(s)	371, 1994, 2069
BsmI	GAATGC	2 cut(s)	209, 1411
BsnI	GGCC	2 cut(s)	1650, 1808
Bso31I	GGTCTC	2 cut(s)	706, 1879
BsoBI	CYCGRG	2 cut(s)	98, 1320
Bsp119I	TTCGAA	1 cut(s)	1662
Bsp1286I	GDGCHC	4 cut(s)	305, 937, 1321, 1707
Bsp143I	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
Bsp19I	CCATGG	2 cut(s)	1599, 1834
BspANI	GGCC	2 cut(s)	1650, 1808
BspCNI	CTCAG	4 cut(s)	995, 1858, 1882, 2064
BspDI	ATCGAT	1 cut(s)	1163
BspHI	TCATGA	1 cut(s)	1974
BspLI	GGNNCC	3 cut(s)	387, 1832, 2001
BspPI	GGATC	4 cut(s)	1033, 1230, 1825, 1838
BspT104I	TTCGAA	1 cut(s)	1662
BspTNI	GGTCTC	2 cut(s)	706, 1879
BsrI	ACTGG	2 cut(s)	134, 981
BssECI	CCNNGG	4 cut(s)	476, 1599, 1645, 1834
BssMI	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
BssSI	CACGAG	2 cut(s)	298, 796
BssT1I	CCWWGG	4 cut(s)	476, 1599, 1645, 1834
Bst2BI	CACGAG	2 cut(s)	298, 796
Bst2UI	CCWGG	2 cut(s)	1123, 2004
Bst4CI	ACNGT	1 cut(s)	997
Bst6I	CTCTTC	6 cut(s)	165, 250, 289, 294, 499, 1554
BstBAI	YACGTR	1 cut(s)	188
BstBI	TTCGAA	1 cut(s)	1662
BstC8I	GCNNGC	2 cut(s)	1300, 1714
BstDEI	CTNAG	7 cut(s)	69, 982, 1004, 1136, 1866, 1890, 2072
BstDSI	CCRYGG	2 cut(s)	1599, 1834
BstHHI	GCGC	1 cut(s)	2012
BstKTI	GATC	8 cut(s)	795, 1028, 1135, 1225, 1433, 1591, 1726, 1833
BstMAI	GTCTC	3 cut(s)	228, 706, 1879
BstMBI	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
BstMWI	GCNNNNNNNGC	4 cut(s)	1235, 1325, 1786, 1805
BstNI	CCWGG	2 cut(s)	1123, 2004
BstNSI	RCATGY	3 cut(s)	1423, 1623, 1927
BstSCI	CCNGG	2 cut(s)	1121, 2002
BstSLI	GKGCMC	1 cut(s)	305
BstV1I	GCAGC	4 cut(s)	1528, 1874, 1918, 1921
BstX2I	RGATCY	3 cut(s)	1025, 1132, 1830
BstYI	RGATCY	3 cut(s)	1025, 1132, 1830
Bsu15I	ATCGAT	1 cut(s)	1163
BsuRI	GGCC	2 cut(s)	1650, 1808
BsuTUI	ATCGAT	1 cut(s)	1163
BtgI	CCRYGG	2 cut(s)	1599, 1834
BtrI	CACGTC	1 cut(s)	2023
BtsI	GCAGTG	1 cut(s)	1354
BtsIMutI	CAGTG	2 cut(s)	990, 1354
Cac8I	GCNNGC	2 cut(s)	1300, 1714
CciI	TCATGA	1 cut(s)	1974
CfoI	GCGC	1 cut(s)	2012
Cfr13I	GGNCC	2 cut(s)	385, 1806
ClaI	ATCGAT	1 cut(s)	1163
Csp6I	GTAC	5 cut(s)	252, 864, 1068, 1523, 1903
CspCI	CAANNNNNGTGG	4 cut(s)	586, 621, 1798, 1833
CviQI	GTAC	5 cut(s)	252, 864, 1068, 1523, 1903
DdeI	CTNAG	7 cut(s)	69, 982, 1004, 1136, 1866, 1890, 2072
DpnI	GATC	8 cut(s)	794, 1027, 1134, 1224, 1432, 1590, 1725, 1832
DpnII	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
DraI	TTTAAA	1 cut(s)	1575
Eam1104I	CTCTTC	6 cut(s)	165, 250, 289, 294, 499, 1554
EarI	CTCTTC	6 cut(s)	165, 250, 289, 294, 499, 1554
Eco130I	CCWWGG	4 cut(s)	476, 1599, 1645, 1834
Eco31I	GGTCTC	2 cut(s)	706, 1879
Eco47I	GGWCC	1 cut(s)	385
Eco57I	CTGAAG	1 cut(s)	888
Eco72I	CACGTG	1 cut(s)	188
Eco88I	CYCGRG	2 cut(s)	98, 1320
EcoRI	GAATTC	3 cut(s)	451, 784, 1894
EcoRII	CCWGG	2 cut(s)	1121, 2002
EcoT14I	CCWWGG	4 cut(s)	476, 1599, 1645, 1834
EcoT22I	ATGCAT	2 cut(s)	1053, 1105
ErhI	CCWWGG	4 cut(s)	476, 1599, 1645, 1834
FalI	AAGNNNNNCTT	2 cut(s)	1765, 1797
FaqI	GGGAC	3 cut(s)	371, 1994, 2069
FauNDI	CATATG	2 cut(s)	499, 546
Fnu4HI	GCNGC	4 cut(s)	1542, 1863, 1932, 1935
Fsp4HI	GCNGC	4 cut(s)	1542, 1863, 1932, 1935
FspBI	CTAG	4 cut(s)	249, 660, 1955, 1959
GlaI	GCGC	1 cut(s)	2011
GluI	GCNGC	4 cut(s)	1542, 1863, 1932, 1935
GsuI	CTGGAG	2 cut(s)	921, 959
HaeIII	GGCC	2 cut(s)	1650, 1808
HapII	CCGG	1 cut(s)	569
HhaI	GCGC	1 cut(s)	2012
Hin6I	GCGC	1 cut(s)	2010
HinP1I	GCGC	1 cut(s)	2010
HincII	GTYRAC	1 cut(s)	2020
HindII	GTYRAC	1 cut(s)	2020
HindIII	AAGCTT	2 cut(s)	392, 1236
HinfI	GANTC	6 cut(s)	60, 143, 155, 980, 1466, 2034
HpaII	CCGG	1 cut(s)	569
HphI	GGTGA	5 cut(s)	152, 620, 1541, 1684, 2039
Hpy166II	GTNNAC	5 cut(s)	131, 303, 332, 1417, 2020
Hpy188I	TCNGA	4 cut(s)	205, 356, 1097, 1815
Hpy188III	TCNNGA	9 cut(s)	55, 100, 365, 518, 938, 1269, 1632, 1694, 1975
Hpy8I	GTNNAC	5 cut(s)	131, 303, 332, 1417, 2020
HpyAV	CCTTC	6 cut(s)	77, 185, 628, 1036, 1474, 1990
HpyCH4III	ACNGT	1 cut(s)	997
HpyCH4IV	ACGT	4 cut(s)	187, 1287, 1372, 2022
HpyF10VI	GCNNNNNNNGC	4 cut(s)	1235, 1325, 1786, 1805
HpyF3I	CTNAG	7 cut(s)	69, 982, 1004, 1136, 1866, 1890, 2072
HpySE526I	ACGT	4 cut(s)	187, 1287, 1372, 2022
HspAI	GCGC	1 cut(s)	2010
Kzo9I	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
LmnI	GCTCC	4 cut(s)	240, 1702, 1820, 2005
Lsp1109I	GCAGC	4 cut(s)	1528, 1874, 1918, 1921
MaeI	CTAG	4 cut(s)	249, 660, 1955, 1959
MaeII	ACGT	4 cut(s)	187, 1287, 1372, 2022
MaeIII	GTNAC	5 cut(s)	397, 1183, 1288, 1489, 1594
MalI	GATC	8 cut(s)	794, 1027, 1134, 1224, 1432, 1590, 1725, 1832
MboI	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
MboII	GAAGA	9 cut(s)	152, 237, 276, 281, 486, 1005, 1181, 1325, 1571
MflI	RGATCY	3 cut(s)	1025, 1132, 1830
MhlI	GDGCHC	4 cut(s)	305, 937, 1321, 1707
MlyI	GAGTC	1 cut(s)	974
MmeI	TCCRAC	4 cut(s)	597, 1606, 1925, 2076
Mph1103I	ATGCAT	2 cut(s)	1053, 1105
MseI	TTAA	9 cut(s)	174, 231, 417, 504, 1032, 1106, 1574, 1913, 2105
MslI	CAYNNNNRTG	1 cut(s)	429
MspA1I	CMGCKG	2 cut(s)	1865, 2071
MspI	CCGG	1 cut(s)	569
MspR9I	CCNGG	2 cut(s)	1123, 2004
MssI	GTTTAAAC	1 cut(s)	1575
Mva1269I	GAATGC	2 cut(s)	209, 1411
MvaI	CCWGG	2 cut(s)	1123, 2004
MwoI	GCNNNNNNNGC	4 cut(s)	1235, 1325, 1786, 1805
NcoI	CCATGG	2 cut(s)	1599, 1834
NdeI	CATATG	2 cut(s)	499, 546
NdeII	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
NlaIV	GGNNCC	3 cut(s)	387, 1832, 2001
NmeAIII	GCCGAG	1 cut(s)	150
NmuCI	GTSAC	2 cut(s)	397, 1183
NsiI	ATGCAT	2 cut(s)	1053, 1105
NspI	RCATGY	3 cut(s)	1423, 1623, 1927
NspV	TTCGAA	1 cut(s)	1662
PaeR7I	CTCGAG	1 cut(s)	98
PagI	TCATGA	1 cut(s)	1974
PciI	ACATGT	2 cut(s)	1419, 1923
PctI	GAATGC	2 cut(s)	209, 1411
PfeI	GAWTC	5 cut(s)	60, 143, 155, 1466, 2034
PflFI	GACNNNGTC	1 cut(s)	1091
PfoI	TCCNGGA	1 cut(s)	2002
PkrI	GCNGC	4 cut(s)	1543, 1864, 1933, 1936
PleI	GAGTC	1 cut(s)	974
PmaCI	CACGTG	1 cut(s)	188
PmeI	GTTTAAAC	1 cut(s)	1575
PmlI	CACGTG	1 cut(s)	188
PpsI	GAGTC	1 cut(s)	974
Ppu21I	YACGTR	1 cut(s)	188
PscI	ACATGT	2 cut(s)	1419, 1923
PshBI	ATTAAT	1 cut(s)	1106
PsiI	TTATAA	1 cut(s)	881
Psp6I	CCWGG	2 cut(s)	1121, 2002
PspCI	CACGTG	1 cut(s)	188
PspGI	CCWGG	2 cut(s)	1121, 2002
PspN4I	GGNNCC	3 cut(s)	387, 1832, 2001
PspPI	GGNCC	2 cut(s)	385, 1806
PsuI	RGATCY	3 cut(s)	1025, 1132, 1830
PsyI	GACNNNGTC	1 cut(s)	1091
PvuII	CAGCTG	2 cut(s)	1865, 2071
RsaI	GTAC	5 cut(s)	253, 865, 1069, 1524, 1904
RsaNI	GTAC	5 cut(s)	252, 864, 1068, 1523, 1903
RseI	CAYNNNNRTG	1 cut(s)	429
SaqAI	TTAA	9 cut(s)	174, 231, 417, 504, 1032, 1106, 1574, 1913, 2105
SatI	GCNGC	4 cut(s)	1542, 1863, 1932, 1935
Sau3AI	GATC	8 cut(s)	792, 1025, 1132, 1222, 1430, 1588, 1723, 1830
Sau96I	GGNCC	2 cut(s)	385, 1806
SchI	GAGTC	1 cut(s)	974
ScrFI	CCNGG	2 cut(s)	1123, 2004
SduI	GDGCHC	4 cut(s)	305, 937, 1321, 1707
Sfr274I	CTCGAG	1 cut(s)	98
SfuI	TTCGAA	1 cut(s)	1662
SinI	GGWCC	1 cut(s)	385
SlaI	CTCGAG	1 cut(s)	98
SmiMI	CAYNNNNRTG	1 cut(s)	429
SmlI	CTYRAG	3 cut(s)	98, 596, 910
SmoI	CTYRAG	3 cut(s)	98, 596, 910
SspMI	CTAG	4 cut(s)	249, 660, 1955, 1959
StyD4I	CCNGG	2 cut(s)	1121, 2002
StyI	CCWWGG	4 cut(s)	476, 1599, 1645, 1834
TaaI	ACNGT	1 cut(s)	997
TaiI	ACGT	4 cut(s)	190, 1290, 1375, 2025
TaqI	TCGA	5 cut(s)	99, 410, 1163, 1225, 1662
TatI	WGTACW	2 cut(s)	251, 1522
TfiI	GAWTC	5 cut(s)	60, 143, 155, 1466, 2034
Tru1I	TTAA	9 cut(s)	174, 231, 417, 504, 1032, 1106, 1574, 1913, 2105
Tru9I	TTAA	9 cut(s)	174, 231, 417, 504, 1032, 1106, 1574, 1913, 2105
TscAI	CASTG	2 cut(s)	990, 1361
TseFI	GTSAC	2 cut(s)	397, 1183
TseI	GCWGC	4 cut(s)	1541, 1862, 1931, 1934
Tsp45I	GTSAC	2 cut(s)	397, 1183
TspRI	CASTG	2 cut(s)	990, 1361
Tth111I	GACNNNGTC	1 cut(s)	1091
VneI	GTGCAC	1 cut(s)	301
VpaK11BI	GGWCC	1 cut(s)	385
VspI	ATTAAT	1 cut(s)	1106
XapI	RAATTY	8 cut(s)	451, 481, 676, 784, 1349, 1653, 1894, 2082
XceI	RCATGY	3 cut(s)	1423, 1623, 1927
XhoI	CTCGAG	1 cut(s)	98
XspI	CTAG	4 cut(s)	249, 660, 1955, 1959
Zsp2I	ATGCAT	2 cut(s)	1053, 1105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.