Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014203.1

Orthogroup ID

OG0004183

Physical Location & Seq

Genomic Coordinates Forward (+)

34917 .. 36353

Gene Structure 1437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014203.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1437 bp

atgtttgatgtctcgttttcgctgcgtcatgactttgctcgagtttgggctttggcctctgagaaactcacttctcttgagattggctacgtttcatctgtaatggtgactgaactacttagcccaaatttcaaattaccgcagtcagcaaatcgtattcagccttccatattgcctaatattcataaattgtccctttccgtcgactacataactgatgccatggttggtactgtatctaaaggtctcacctccttgacccatttggatcttcgggatgcacccctcattgaaccaagagttacatttgaccttaccaactctggccttcaactgataaatcagcatggaaagttgaagcatttatcattggttcggagccaggagtttctcttcacatatttcaaacgagtaaatgatcttgggctccttttattagccgacaagtgtgaaaagatggaaagtatatttctcagtggcttctgtcgtgttacagacacaggtttcaaaacaatcttgcattcttgctctacgctctacaagcttagggtttctcatgggactcagttaactgatctggtttttcatgacatctctgcaacttccctttctttaacacacgttagcttgagacggtgtacacttttaaccaaccatgcagtcactaatttggcttctaacaaggatctaaaagttcttgatttgagagattgcagaaaccttgggaatgaagccctccgagccataggcaatcttcataatttgaagaccttattattggatggctccgatatcagtgatctgggattatcatacttaagaccaagggttataagttcactaattacattgtctgttagaggctgcaagaaactgactgataaatgcatctctgctctatttgatggctcttctaaattggcgttgcaagaattggacctatcaaatcttccgaatctctctgacaatggagttttattacttgcaagaagtaggattccgttattggaactacgaatgcgacaatgcccactcataggtgacacatctgtagtggtattagcttcaatgctggtagacgaggaaaggtggcatggtaattgcttgcggttgttggatctgtttaactgtggtggcattaccgtggttgcatttcggtggctgaagaaaccatattttccaaggctaaggtggttgggggttacaggttgtgtaaatagagatacagtagatgctttagctcgtagtagaccgttcttgcatgtgtcatgccatggtgaggagctgggggcagagcagtgggataccggggacgactttcatatgcatgactatgatgagatggatgagcttgaacagtggcttcaagaaggtgactatgagagtggcgatgaagagatggtggaggcagaaaacgttgcagaagcggtggagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box LRR_6

Protein Analysis

478

Amino Acids

53.58

Weight (kDa)

5.75

Isoelectric Point (pI)

39.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004183)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G17020 AT2G17020 AT2G17020
fragaria_vesca	FvH4_2g15790 FvH4_2g15790 FvH4_2g15790 FvH4_2g15790 FvH4_2g15790
malus_domestica	MD05G1089200.v1.1 MD05G1127000.v1.1 MD10G1130200.v1.1 MD10G1130400.v1.1
prunus_persica	Prupe.8G170700_v2.0.a1 Prupe.8G170700_v2.0.a1 Prupe.8G170700_v2.0.a1 Prupe.8G170700_v2.0.a1
pyrus_communis	pycom05g12280 pycom10g11150 pycom10g11170
rosa_chinensis	RchiOBHm_Chr6g0279151
rosa_laevigata	RLG00000013161
rosa_multiflora	Rmu_co8081166.1_g000001 Rmu_sc0014203.1_g000013 Rmu_sc0014536.1_g000008
rosa_roxburghii	Rroxscaffold_7G00189070
rosa_rugosa	Rorug06G0123000 Rorug06G0123100 Rorug06G0123200
rosa_samantha	Rh6AG231600 Rh6BG236500 Rh6CG238500 Rh6DG230100
rosa_wichuraiana	Rw6G020270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	833
AccI	GTMKAC	3 cut(s)	204, 1077, 1249
AciI	CCGC	3 cut(s)	140, 1108, 1427
AclI	AACGTT	1 cut(s)	1416
AclWI	GGATC	3 cut(s)	276, 693, 1125
AcsI	RAATTY	1 cut(s)	127
AcuI	CTGAAG	1 cut(s)	1184
AfaI	GTAC	2 cut(s)	232, 640
AfiI	CCNNNNNNNGG	2 cut(s)	1037, 1279
AflII	CTTAAG	1 cut(s)	817
AflIII	ACRYGT	1 cut(s)	619
AjnI	CCWGG	1 cut(s)	381
AluBI	AGCT	6 cut(s)	544, 627, 1064, 1241, 1285, 1351
AluI	AGCT	6 cut(s)	544, 627, 1064, 1241, 1285, 1351
Alw26I	GTCTC	3 cut(s)	16, 251, 625
AlwI	GGATC	3 cut(s)	276, 693, 1125
Ama87I	CYCGRG	1 cut(s)	39
AoxI	GGCC	2 cut(s)	54, 325
ApeKI	GCWGC	2 cut(s)	22, 864
ApoI	RAATTY	1 cut(s)	127
AspS9I	GGNCC	1 cut(s)	937
AsuC2I	CCSGG	1 cut(s)	1309
AsuHPI	GGTGA	5 cut(s)	118, 241, 1052, 1289, 1385
AvaI	CYCGRG	1 cut(s)	39
AvaII	GGWCC	1 cut(s)	937
BanII	GRGCYC	1 cut(s)	429
BarI	GAAGNNNNNNTAC	2 cut(s)	148, 180
BbsI	GAAGAC	1 cut(s)	773
BbvI	GCAGC	2 cut(s)	9, 851
BccI	CCATC	5 cut(s)	451, 776, 899, 1336, 1393
BciT130I	CCWGG	1 cut(s)	383
BciVI	GTATCC	1 cut(s)	1297
BcnI	CCSGG	1 cut(s)	1309
BcoDI	GTCTC	3 cut(s)	16, 251, 625
BfmI	CTRYAG	1 cut(s)	1050
BfrI	CTTAAG	1 cut(s)	817
BfuI	GTATCC	1 cut(s)	1297
BisI	GCNGC	2 cut(s)	23, 865
BlsI	GCNGC	2 cut(s)	24, 866
Bme1390I	CCNGG	2 cut(s)	383, 1309
Bme18I	GGWCC	1 cut(s)	937
BmeT110I	CYCGRG	1 cut(s)	39
BmgT120I	GGNCC	1 cut(s)	937
BmiI	GGNNCC	3 cut(s)	380, 428, 787
BmrFI	CCNGG	2 cut(s)	383, 1309
BmsI	GCATC	4 cut(s)	208, 268, 897, 1222
BpiI	GAAGAC	1 cut(s)	773
Bpu10I	CCTNAGC	2 cut(s)	545, 1187
BpuEI	CTTGAG	2 cut(s)	98, 649
BpuMI	CCSGG	1 cut(s)	1309
BsaI	GGTCTC	1 cut(s)	251
BsaJI	CCNNGG	7 cut(s)	222, 721, 824, 1143, 1181, 1273, 1308
Bsc4I	CCNNNNNNNGG	2 cut(s)	1037, 1279
BseBI	CCWGG	1 cut(s)	383
BseDI	CCNNGG	7 cut(s)	222, 721, 824, 1143, 1181, 1273, 1308
BseGI	GGATG	3 cut(s)	283, 787, 1351
BseLI	CCNNNNNNNGG	2 cut(s)	1037, 1279
BseMII	CTCAG	3 cut(s)	51, 487, 578
BseRI	GAGGAG	1 cut(s)	1295
BseXI	GCAGC	2 cut(s)	9, 851
BseYI	CCCAGC	1 cut(s)	1285
BshFI	GGCC	2 cut(s)	56, 327
BsiHKCI	CYCGRG	1 cut(s)	39
BsiSI	CCGG	1 cut(s)	1308
BslFI	GGGAC	3 cut(s)	178, 574, 1325
BslI	CCNNNNNNNGG	2 cut(s)	1037, 1279
BsmAI	GTCTC	3 cut(s)	16, 251, 625
BsmBI	CGTCTC	1 cut(s)	625
BsmFI	GGGAC	3 cut(s)	178, 574, 1325
BsmI	GAATGC	2 cut(s)	520, 1023
BsnI	GGCC	2 cut(s)	56, 327
Bso31I	GGTCTC	1 cut(s)	251
BsoBI	CYCGRG	1 cut(s)	39
Bsp1286I	GDGCHC	1 cut(s)	429
Bsp1407I	TGTACA	1 cut(s)	638
Bsp143I	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
Bsp19I	CCATGG	2 cut(s)	222, 1273
BspACI	CCGC	3 cut(s)	140, 1108, 1427
BspANI	GGCC	2 cut(s)	56, 327
BspCNI	CTCAG	3 cut(s)	52, 486, 577
BspHI	TCATGA	2 cut(s)	28, 586
BspLI	GGNNCC	3 cut(s)	380, 428, 787
BspPI	GGATC	3 cut(s)	276, 693, 1125
BspQI	GCTCTTC	1 cut(s)	916
BspTI	CTTAAG	1 cut(s)	817
BspTNI	GGTCTC	1 cut(s)	251
BsrGI	TGTACA	1 cut(s)	638
BssECI	CCNNGG	7 cut(s)	222, 721, 824, 1143, 1181, 1273, 1308
BssMI	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
BssT1I	CCWWGG	5 cut(s)	222, 721, 824, 1181, 1273
Bst2UI	CCWGG	1 cut(s)	383
Bst4CI	ACNGT	7 cut(s)	235, 636, 1130, 1144, 1228, 1254, 1359
Bst6I	CTCTTC	3 cut(s)	398, 916, 1389
BstAFI	CTTAAG	1 cut(s)	817
BstAUI	TGTACA	1 cut(s)	638
BstC8I	GCNNGC	1 cut(s)	1106
BstDEI	CTNAG	6 cut(s)	60, 119, 473, 545, 564, 1187
BstDSI	CCRYGG	3 cut(s)	222, 1143, 1273
BstF5I	GGATG	3 cut(s)	283, 787, 1351
BstKTI	GATC	6 cut(s)	271, 421, 577, 688, 802, 1120
BstMAI	GTCTC	3 cut(s)	16, 251, 625
BstMBI	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
BstMWI	GCNNNNNNNGC	2 cut(s)	541, 740
BstNI	CCWGG	1 cut(s)	383
BstNSI	RCATGY	1 cut(s)	1265
BstSCI	CCNGG	2 cut(s)	381, 1307
BstSFI	CTRYAG	1 cut(s)	1050
BstV1I	GCAGC	2 cut(s)	9, 851
BstV2I	GAAGAC	1 cut(s)	773
BstX2I	RGATCY	3 cut(s)	268, 685, 1117
BstYI	RGATCY	3 cut(s)	268, 685, 1117
BsuI	GTATCC	1 cut(s)	1297
BsuRI	GGCC	2 cut(s)	56, 327
BtgI	CCRYGG	3 cut(s)	222, 1143, 1273
BtgZI	GCGATG	1 cut(s)	1404
BtsCI	GGATG	3 cut(s)	283, 787, 1351
BtsI	GCAGTG	1 cut(s)	1304
BtsIMutI	CAGTG	4 cut(s)	481, 802, 1304, 1364
Cac8I	GCNNGC	1 cut(s)	1106
CciI	TCATGA	2 cut(s)	28, 586
Cfr13I	GGNCC	1 cut(s)	937
CseI	GACGC	1 cut(s)	14
Csp6I	GTAC	2 cut(s)	231, 639
CviQI	GTAC	2 cut(s)	231, 639
DdeI	CTNAG	6 cut(s)	60, 119, 473, 545, 564, 1187
DpnI	GATC	6 cut(s)	270, 420, 576, 687, 801, 1119
DpnII	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
Eam1104I	CTCTTC	3 cut(s)	398, 916, 1389
EarI	CTCTTC	3 cut(s)	398, 916, 1389
Eco130I	CCWWGG	5 cut(s)	222, 721, 824, 1181, 1273
Eco24I	GRGCYC	1 cut(s)	429
Eco31I	GGTCTC	1 cut(s)	251
Eco32I	GATATC	1 cut(s)	793
Eco47I	GGWCC	1 cut(s)	937
Eco57I	CTGAAG	1 cut(s)	1184
Eco88I	CYCGRG	1 cut(s)	39
EcoRII	CCWGG	1 cut(s)	381
EcoRV	GATATC	1 cut(s)	793
EcoT14I	CCWWGG	5 cut(s)	222, 721, 824, 1181, 1273
EcoT22I	ATGCAT	2 cut(s)	890, 1329
EcoT38I	GRGCYC	1 cut(s)	429
ErhI	CCWWGG	5 cut(s)	222, 721, 824, 1181, 1273
Esp3I	CGTCTC	1 cut(s)	625
FaqI	GGGAC	3 cut(s)	178, 574, 1325
FauNDI	CATATG	1 cut(s)	1323
FblI	GTMKAC	3 cut(s)	204, 1077, 1249
Fnu4HI	GCNGC	2 cut(s)	23, 865
FokI	GGATG	3 cut(s)	290, 794, 1358
FriOI	GRGCYC	1 cut(s)	429
Fsp4HI	GCNGC	2 cut(s)	23, 865
GluI	GCNGC	2 cut(s)	23, 865
GsaI	CCCAGC	1 cut(s)	1289
HaeIII	GGCC	2 cut(s)	56, 327
HapII	CCGG	1 cut(s)	1308
HgaI	GACGC	1 cut(s)	14
HincII	GTYRAC	2 cut(s)	205, 570
HindII	GTYRAC	2 cut(s)	205, 570
HindIII	AAGCTT	1 cut(s)	542
HinfI	GANTC	3 cut(s)	562, 955, 997
HpaI	GTTAAC	1 cut(s)	570
HpaII	CCGG	1 cut(s)	1308
HphI	GGTGA	5 cut(s)	118, 241, 1052, 1289, 1385
Hpy166II	GTNNAC	7 cut(s)	205, 570, 639, 641, 839, 1078, 1250
Hpy188I	TCNGA	6 cut(s)	61, 378, 740, 790, 954, 964
Hpy188III	TCNNGA	6 cut(s)	29, 77, 275, 587, 698, 1367
Hpy8I	GTNNAC	7 cut(s)	205, 570, 639, 641, 839, 1078, 1250
Hpy99I	CGWCG	1 cut(s)	206
HpyAV	CCTTC	3 cut(s)	174, 338, 1364
HpyCH4III	ACNGT	7 cut(s)	235, 636, 1130, 1144, 1228, 1254, 1359
HpyCH4IV	ACGT	3 cut(s)	90, 621, 1416
HpyF10VI	GCNNNNNNNGC	2 cut(s)	541, 740
HpyF3I	CTNAG	6 cut(s)	60, 119, 473, 545, 564, 1187
HpySE526I	ACGT	3 cut(s)	90, 621, 1416
KspAI	GTTAAC	1 cut(s)	570
Kzo9I	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
LguI	GCTCTTC	1 cut(s)	916
LmnI	GCTCC	4 cut(s)	378, 432, 791, 1282
Lsp1109I	GCAGC	2 cut(s)	9, 851
LweI	GCATC	4 cut(s)	208, 268, 897, 1222
MaeII	ACGT	3 cut(s)	90, 621, 1416
MaeIII	GTNAC	7 cut(s)	106, 301, 490, 661, 1040, 1201, 1373
MalI	GATC	6 cut(s)	270, 420, 576, 687, 801, 1119
MboI	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
MboII	GAAGA	8 cut(s)	263, 385, 746, 778, 903, 941, 1177, 1406
MflI	RGATCY	3 cut(s)	268, 685, 1117
MhlI	GDGCHC	1 cut(s)	429
MluCI	AATT	9 cut(s)	127, 134, 188, 667, 760, 843, 917, 932, 1099
MlyI	GAGTC	1 cut(s)	556
MmeI	TCCRAC	1 cut(s)	1095
MnlI	CCTC	8 cut(s)	67, 262, 296, 746, 854, 1075, 1273, 1399
Mph1103I	ATGCAT	2 cut(s)	890, 1329
MseI	TTAA	5 cut(s)	569, 614, 647, 818, 1125
MslI	CAYNNNNRTG	4 cut(s)	1142, 1156, 1326, 1332
MspCI	CTTAAG	1 cut(s)	817
MspI	CCGG	1 cut(s)	1308
MspR9I	CCNGG	2 cut(s)	383, 1309
Mva1269I	GAATGC	2 cut(s)	520, 1023
MvaI	CCWGG	1 cut(s)	383
MwoI	GCNNNNNNNGC	2 cut(s)	541, 740
NciI	CCSGG	1 cut(s)	1309
NcoI	CCATGG	2 cut(s)	222, 1273
NdeI	CATATG	1 cut(s)	1323
NdeII	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
NlaIV	GGNNCC	3 cut(s)	380, 428, 787
NmuCI	GTSAC	4 cut(s)	106, 661, 1040, 1373
NsiI	ATGCAT	2 cut(s)	890, 1329
NspI	RCATGY	1 cut(s)	1265
PaeR7I	CTCGAG	1 cut(s)	39
PagI	TCATGA	2 cut(s)	28, 586
PciSI	GCTCTTC	1 cut(s)	916
PctI	GAATGC	2 cut(s)	520, 1023
PfeI	GAWTC	2 cut(s)	955, 997
PkrI	GCNGC	2 cut(s)	24, 866
PleI	GAGTC	1 cut(s)	556
PpsI	GAGTC	1 cut(s)	556
PsiI	TTATAA	1 cut(s)	833
Psp1406I	AACGTT	1 cut(s)	1416
Psp6I	CCWGG	1 cut(s)	381
PspFI	CCCAGC	1 cut(s)	1285
PspGI	CCWGG	1 cut(s)	381
PspN4I	GGNNCC	3 cut(s)	380, 428, 787
PspPI	GGNCC	1 cut(s)	937
PspXI	VCTCGAGB	1 cut(s)	39
PsuI	RGATCY	3 cut(s)	268, 685, 1117
RsaI	GTAC	2 cut(s)	232, 640
RsaNI	GTAC	2 cut(s)	231, 639
RseI	CAYNNNNRTG	4 cut(s)	1142, 1156, 1326, 1332
SalI	GTCGAC	1 cut(s)	203
SapI	GCTCTTC	1 cut(s)	916
SaqAI	TTAA	5 cut(s)	569, 614, 647, 818, 1125
SatI	GCNGC	2 cut(s)	23, 865
Sau3AI	GATC	6 cut(s)	268, 418, 574, 685, 799, 1117
Sau96I	GGNCC	1 cut(s)	937
SchI	GAGTC	1 cut(s)	556
ScrFI	CCNGG	2 cut(s)	383, 1309
SduI	GDGCHC	1 cut(s)	429
SfaNI	GCATC	4 cut(s)	208, 268, 897, 1222
SfcI	CTRYAG	1 cut(s)	1050
Sfr274I	CTCGAG	1 cut(s)	39
SinI	GGWCC	1 cut(s)	937
SlaI	CTCGAG	1 cut(s)	39
SmiMI	CAYNNNNRTG	4 cut(s)	1142, 1156, 1326, 1332
SmlI	CTYRAG	4 cut(s)	39, 77, 628, 817
SmoI	CTYRAG	4 cut(s)	39, 77, 628, 817
Sse9I	AATT	9 cut(s)	127, 134, 188, 667, 760, 843, 917, 932, 1099
SsiI	CCGC	3 cut(s)	140, 1108, 1427
SspI	AATATT	1 cut(s)	181
StyD4I	CCNGG	2 cut(s)	381, 1307
StyI	CCWWGG	5 cut(s)	222, 721, 824, 1181, 1273
TaaI	ACNGT	7 cut(s)	235, 636, 1130, 1144, 1228, 1254, 1359
TaiI	ACGT	3 cut(s)	93, 624, 1419
TaqI	TCGA	2 cut(s)	40, 204
TasI	AATT	9 cut(s)	127, 134, 188, 667, 760, 843, 917, 932, 1099
TatI	WGTACW	1 cut(s)	638
TfiI	GAWTC	2 cut(s)	955, 997
Tru1I	TTAA	5 cut(s)	569, 614, 647, 818, 1125
Tru9I	TTAA	5 cut(s)	569, 614, 647, 818, 1125
TscAI	CASTG	4 cut(s)	481, 802, 1304, 1364
TseFI	GTSAC	4 cut(s)	106, 661, 1040, 1373
TseI	GCWGC	2 cut(s)	22, 864
Tsp45I	GTSAC	4 cut(s)	106, 661, 1040, 1373
TspDTI	ATGAA	7 cut(s)	84, 173, 575, 744, 746, 1310, 1407
TspGWI	ACGGA	2 cut(s)	190, 990
TspRI	CASTG	4 cut(s)	481, 802, 1304, 1364
Vha464I	CTTAAG	1 cut(s)	817
VpaK11BI	GGWCC	1 cut(s)	937
XapI	RAATTY	1 cut(s)	127
XceI	RCATGY	1 cut(s)	1265
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1188
XhoI	CTCGAG	1 cut(s)	39
XmiI	GTMKAC	3 cut(s)	204, 1077, 1249
Zsp2I	ATGCAT	2 cut(s)	890, 1329

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.