Rorug06G0123200

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
17106669 .. 17106839
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0123200.1

Sequence Viewer

Length: 171 bp
ATGGCGTGGAGGGTCATCGACATGTTCGTCAAAAGGGATAAATACAAGCATACAGCAGAGTATTTAATTGAGAACTACAATTGCAATTGTGTTGGAGTACAGAAGAAGGGCCAAGCTAGAGGCTACGTTCTCAACCCAAAAACCCACAAAAATTTCTGGGTTCTTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.68

Weight (kDa)

9.64

Isoelectric Point (pI)

13.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 26
AcsI RAATTY 1 cut(s) 151
AfaI GTAC 1 cut(s) 99
AflIII ACRYGT 1 cut(s) 21
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
AoxI GGCC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 109
BfaI CTAG 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 109
BshFI GGCC 1 cut(s) 111
BsnI GGCC 1 cut(s) 111
BspANI GGCC 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 25
BsuRI GGCC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 98
CviAII CATG 1 cut(s) 22
CviJI RGCY 3 cut(s) 111, 116, 123
CviKI_1 RGCY 3 cut(s) 111, 116, 123
CviQI GTAC 1 cut(s) 98
DrdI GACNNNNNNGTC 1 cut(s) 26
DseDI GACNNNNNNGTC 1 cut(s) 26
FaeI CATG 1 cut(s) 25
FaiI YATR 3 cut(s) 23, 51, 169
FatI CATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 84, 167
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 1 cut(s) 25
LpnPI CCDG 1 cut(s) 142
MaeI CTAG 1 cut(s) 117
MaeII ACGT 1 cut(s) 126
MboII GAAGA 1 cut(s) 115
MfeI CAATTG 2 cut(s) 79, 85
MluCI AATT 4 cut(s) 66, 79, 85, 151
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 2 cut(s) 3, 113
MseI TTAA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 20
MunI CAATTG 2 cut(s) 79, 85
NlaIII CATG 1 cut(s) 25
NspI RCATGY 1 cut(s) 25
PciI ACATGT 1 cut(s) 21
PcsI WCGNNNNNNNCGW 1 cut(s) 24
PscI ACATGT 1 cut(s) 21
PspPI GGNCC 1 cut(s) 109
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 20
SaqAI TTAA 1 cut(s) 65
Sau96I GGNCC 1 cut(s) 109
SetI ASST 2 cut(s) 118, 129
SgeI CNNG 5 cut(s) 18, 34, 58, 125, 129
SmiMI CAYNNNNRTG 1 cut(s) 20
Sse9I AATT 4 cut(s) 66, 79, 85, 151
SspMI CTAG 1 cut(s) 117
TaiI ACGT 1 cut(s) 129
TaqI TCGA 1 cut(s) 18
TasI AATT 4 cut(s) 66, 79, 85, 151
TatI WGTACW 1 cut(s) 97
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
XapI RAATTY 1 cut(s) 151
XceI RCATGY 1 cut(s) 25
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.