Rorug06G0123100

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
17072711 .. 17077263
4553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0123100.1

Sequence Viewer

Length: 228 bp
ATGTCATTTGCAGCCTCTGTAAAGGTTCAGGGAGCAAAGGACAAATCAATTTACGTTTGTTTTGGACAAGCAAAGGGTGACAAGTTGTTGGCGTCGCAAAATGCAGAGAGTCATCAGAGGTGTGCTATCGGCTTTTCTAGGAAGGGTGAAAAGGGGAGCGAAAGAGTAAAGAGTAGACGAAAGGAGATGGGCGTTATCATTCATCTACCCATAAAAGGTCTGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.18

Weight (kDa)

10.09

Isoelectric Point (pI)

27.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 175
AcyI GRCGYC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 215
AlwNI CAGNNNCTG 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 11
AsuHPI GGTGA 2 cut(s) 89, 158
BbvI GCAGC 1 cut(s) 23
BccI CCATC 1 cut(s) 181
BfaI CTAG 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 224
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BsaHI GRCGYC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 215
BseLI CCNNNNNNNGG 1 cut(s) 215
BseXI GCAGC 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 215
BssNI GRCGYC 1 cut(s) 92
BstACI GRCGYC 1 cut(s) 92
BstSFI CTRYAG 1 cut(s) 224
BstV1I GCAGC 1 cut(s) 23
CaiI CAGNNNCTG 1 cut(s) 17
CseI GACGC 1 cut(s) 81
CviJI RGCY 2 cut(s) 14, 132
CviKI_1 RGCY 2 cut(s) 14, 132
FaiI YATR 1 cut(s) 212
FblI GTMKAC 1 cut(s) 175
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
FspBI CTAG 1 cut(s) 138
GluI GCNGC 1 cut(s) 12
HgaI GACGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 92
HinfI GANTC 1 cut(s) 109
HphI GGTGA 2 cut(s) 89, 158
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 117
Hpy8I GTNNAC 1 cut(s) 176
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 136
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 2 cut(s) 11, 104
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 1 cut(s) 92
LmnI GCTCC 2 cut(s) 32, 156
LpnPI CCDG 1 cut(s) 14
Lsp1109I GCAGC 1 cut(s) 23
MaeI CTAG 1 cut(s) 138
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 77
MluCI AATT 1 cut(s) 48
MlyI GAGTC 1 cut(s) 118
MnlI CCTC 2 cut(s) 25, 111
NmuCI GTSAC 1 cut(s) 77
PkrI GCNGC 1 cut(s) 13
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
PstNI CAGNNNCTG 1 cut(s) 17
SatI GCNGC 1 cut(s) 12
SchI GAGTC 1 cut(s) 118
SetI ASST 4 cut(s) 27, 57, 122, 220
SfcI CTRYAG 1 cut(s) 224
SgeI CNNG 4 cut(s) 41, 80, 94, 150
Sse9I AATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 138
TaiI ACGT 1 cut(s) 57
TasI AATT 1 cut(s) 48
TseFI GTSAC 1 cut(s) 77
TseI GCWGC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 191
XmiI GTMKAC 1 cut(s) 175
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.