Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014635.1

Orthogroup ID

OG0017406

Physical Location & Seq

Genomic Coordinates Reverse (-)

31491 .. 31916

Gene Structure 426 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014635.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atgccggcattgccagtgaatcaaattacccatacacagaaaaggaaggaacttgtgatactaacaagacaaggccaggactatgctgccaagatcacaagctatgccatcgttgatcttaacagcgagacagaattattaaatgtggtttctaagcaaccggtctcagcaatggttgacagcaaagggagggagttcagactttactttggtggagtcttctctggggaatgtgggacatcactggaccattctgtaacggtcatcgggtatgggacgactgaggatggcatcaagtattggctagtgaaaaattcatggggtgagcactggggagagggtggctacatgagaatccgcagaggggttgatgctccacaaggtctttgtggtattgctaggaatcctttatatccgattgtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 ko04142 ko04145 ko04210 ko04612 ko05205 ko05323 ko05418 map04140 map04142 map04145 map04210 map04612 map05205 map05323 map05418

Pfam Domains

Protein Families

Inhibitor_I29 Peptidase_C1

Protein Analysis

141

Amino Acids

15.62

Weight (kDa)

7.78

Isoelectric Point (pI)

36.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017406)

Species	Orthologous Gene IDs
pyrus_communis	pycom10g23540
rosa_chinensis	RchiOBHm_Chr5g0010611
rosa_laevigata	RLG00000031749 RLG00000031755 RLG00000031765
rosa_multiflora	Rmu_co8158362.1_g000001 Rmu_sc0014635.1_g000006 Rmu_sc0016264.1_g000004
rosa_roxburghii	Rroxscaffold_1G00065760
rosa_samantha	Rh3AG064100 Rh3AG064300 Rh5AG082800 Rh5BG078000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	358
AcsI	RAATTY	1 cut(s)	313
AfiI	CCNNNNNNNGG	1 cut(s)	364
AgeI	ACCGGT	1 cut(s)	160
AjnI	CCWGG	1 cut(s)	75
AluBI	AGCT	1 cut(s)	102
AluI	AGCT	1 cut(s)	102
Alw21I	GWGCWC	1 cut(s)	330
Alw26I	GTCTC	2 cut(s)	122, 169
AoxI	GGCC	1 cut(s)	73
ApeKI	GCWGC	1 cut(s)	86
ApoI	RAATTY	1 cut(s)	313
AsiGI	ACCGGT	1 cut(s)	160
AspS9I	GGNCC	1 cut(s)	247
AsuHPI	GGTGA	1 cut(s)	335
AvaII	GGWCC	1 cut(s)	247
BbsI	GAAGAC	1 cut(s)	211
Bbv12I	GWGCWC	1 cut(s)	330
BbvI	GCAGC	1 cut(s)	73
BccI	CCATC	2 cut(s)	116, 281
BciT130I	CCWGG	1 cut(s)	77
BcoDI	GTCTC	2 cut(s)	122, 169
BfaI	CTAG	2 cut(s)	305, 399
BisI	GCNGC	1 cut(s)	87
BlsI	GCNGC	1 cut(s)	88
Bme1390I	CCNGG	1 cut(s)	77
Bme18I	GGWCC	1 cut(s)	247
BmgT120I	GGNCC	1 cut(s)	247
BmrFI	CCNGG	1 cut(s)	77
BmrI	ACTGGG	1 cut(s)	340
BmsI	GCATC	2 cut(s)	300, 361
BmuI	ACTGGG	1 cut(s)	340
BpiI	GAAGAC	1 cut(s)	211
BsaI	GGTCTC	1 cut(s)	169
BsaWI	WCCGGW	1 cut(s)	160
Bsc4I	CCNNNNNNNGG	1 cut(s)	364
Bse118I	RCCGGY	2 cut(s)	4, 160
Bse1I	ACTGG	3 cut(s)	14, 249, 335
Bse3DI	GCAATG	2 cut(s)	8, 177
BseBI	CCWGG	1 cut(s)	77
BseGI	GGATG	1 cut(s)	292
BseLI	CCNNNNNNNGG	1 cut(s)	364
BseMI	GCAATG	2 cut(s)	8, 177
BseMII	CTCAG	2 cut(s)	180, 273
BseNI	ACTGG	3 cut(s)	14, 249, 335
BseXI	GCAGC	1 cut(s)	73
BshFI	GGCC	1 cut(s)	75
BshTI	ACCGGT	1 cut(s)	160
BsiHKAI	GWGCWC	1 cut(s)	330
BsiSI	CCGG	2 cut(s)	5, 161
BslFI	GGGAC	2 cut(s)	250, 289
BslI	CCNNNNNNNGG	1 cut(s)	364
BsmAI	GTCTC	2 cut(s)	122, 169
BsmFI	GGGAC	2 cut(s)	250, 289
BsnI	GGCC	1 cut(s)	75
Bso31I	GGTCTC	1 cut(s)	169
Bsp1286I	GDGCHC	1 cut(s)	330
Bsp143I	GATC	2 cut(s)	93, 115
BspACI	CCGC	1 cut(s)	358
BspANI	GGCC	1 cut(s)	75
BspCNI	CTCAG	2 cut(s)	179, 274
BspTNI	GGTCTC	1 cut(s)	169
BsrDI	GCAATG	2 cut(s)	8, 177
BsrFI	RCCGGY	2 cut(s)	4, 160
BsrI	ACTGG	3 cut(s)	14, 249, 335
BssAI	RCCGGY	2 cut(s)	4, 160
BssMI	GATC	2 cut(s)	93, 115
Bst2UI	CCWGG	1 cut(s)	77
Bst4CI	ACNGT	1 cut(s)	262
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	3 cut(s)	153, 166, 282
BstF5I	GGATG	1 cut(s)	292
BstKTI	GATC	2 cut(s)	96, 118
BstMAI	GTCTC	2 cut(s)	122, 169
BstMBI	GATC	2 cut(s)	93, 115
BstMWI	GCNNNNNNNGC	1 cut(s)	10
BstNI	CCWGG	1 cut(s)	77
BstSCI	CCNGG	1 cut(s)	75
BstV1I	GCAGC	1 cut(s)	73
BstV2I	GAAGAC	1 cut(s)	211
BsuRI	GGCC	1 cut(s)	75
BtsCI	GGATG	1 cut(s)	292
BtsIMutI	CAGTG	3 cut(s)	21, 242, 328
Cac8I	GCNNGC	1 cut(s)	6
Cfr10I	RCCGGY	2 cut(s)	4, 160
Cfr13I	GGNCC	1 cut(s)	247
CspAI	ACCGGT	1 cut(s)	160
CviAII	CATG	2 cut(s)	318, 349
CviJI	RGCY	4 cut(s)	75, 102, 304, 345
CviKI_1	RGCY	4 cut(s)	75, 102, 304, 345
DdeI	CTNAG	3 cut(s)	153, 166, 282
DpnI	GATC	2 cut(s)	95, 117
DpnII	GATC	2 cut(s)	93, 115
Eco31I	GGTCTC	1 cut(s)	169
Eco47I	GGWCC	1 cut(s)	247
EcoRII	CCWGG	1 cut(s)	75
FaeI	CATG	2 cut(s)	321, 352
FaiI	YATR	7 cut(s)	33, 84, 105, 273, 319, 350, 412
FaqI	GGGAC	2 cut(s)	250, 289
FatI	CATG	2 cut(s)	317, 348
Fnu4HI	GCNGC	1 cut(s)	87
FokI	GGATG	1 cut(s)	299
Fsp4HI	GCNGC	1 cut(s)	87
FspBI	CTAG	2 cut(s)	305, 399
GluI	GCNGC	1 cut(s)	87
HaeIII	GGCC	1 cut(s)	75
HapII	CCGG	2 cut(s)	5, 161
Hin1II	CATG	2 cut(s)	321, 352
HincII	GTYRAC	1 cut(s)	178
HindII	GTYRAC	1 cut(s)	178
HinfI	GANTC	4 cut(s)	19, 216, 354, 403
HpaII	CCGG	2 cut(s)	5, 161
HphI	GGTGA	1 cut(s)	335
Hpy166II	GTNNAC	1 cut(s)	178
Hpy188I	TCNGA	2 cut(s)	200, 417
Hpy8I	GTNNAC	1 cut(s)	178
HpyAV	CCTTC	1 cut(s)	40
HpyCH4III	ACNGT	1 cut(s)	262
HpyF10VI	GCNNNNNNNGC	1 cut(s)	10
HpyF3I	CTNAG	3 cut(s)	153, 166, 282
Hsp92II	CATG	2 cut(s)	321, 352
KroI	GCCGGC	1 cut(s)	4
KroNI	GCCGGC	1 cut(s)	6
Kzo9I	GATC	2 cut(s)	93, 115
LmnI	GCTCC	1 cut(s)	379
LpnPI	CCDG	8 cut(s)	18, 27, 62, 89, 174, 210, 230, 316
Lsp1109I	GCAGC	1 cut(s)	73
LweI	GCATC	2 cut(s)	300, 361
MaeI	CTAG	2 cut(s)	305, 399
MaeIII	GTNAC	1 cut(s)	256
MalI	GATC	2 cut(s)	95, 117
MboI	GATC	2 cut(s)	93, 115
MboII	GAAGA	1 cut(s)	211
MhlI	GDGCHC	1 cut(s)	330
MluCI	AATT	3 cut(s)	24, 134, 313
MlyI	GAGTC	1 cut(s)	225
MnlI	CCTC	4 cut(s)	183, 277, 331, 356
MroNI	GCCGGC	1 cut(s)	4
MseI	TTAA	3 cut(s)	120, 140, 424
MspI	CCGG	2 cut(s)	5, 161
MspR9I	CCNGG	1 cut(s)	77
MvaI	CCWGG	1 cut(s)	77
MwoI	GCNNNNNNNGC	1 cut(s)	10
NaeI	GCCGGC	1 cut(s)	6
NdeII	GATC	2 cut(s)	93, 115
NgoMIV	GCCGGC	1 cut(s)	4
NlaIII	CATG	2 cut(s)	321, 352
PdiI	GCCGGC	1 cut(s)	6
PfeI	GAWTC	3 cut(s)	19, 354, 403
PinAI	ACCGGT	1 cut(s)	160
PkrI	GCNGC	1 cut(s)	88
PleI	GAGTC	1 cut(s)	224
PpsI	GAGTC	1 cut(s)	224
Psp6I	CCWGG	1 cut(s)	75
PspGI	CCWGG	1 cut(s)	75
PspPI	GGNCC	1 cut(s)	247
PsrI	GAACNNNNNNTAC	2 cut(s)	42, 74
SaqAI	TTAA	3 cut(s)	120, 140, 424
SatI	GCNGC	1 cut(s)	87
Sau3AI	GATC	2 cut(s)	93, 115
Sau96I	GGNCC	1 cut(s)	247
SchI	GAGTC	1 cut(s)	225
ScrFI	CCNGG	1 cut(s)	77
SduI	GDGCHC	1 cut(s)	330
SetI	ASST	2 cut(s)	104, 385
SfaNI	GCATC	2 cut(s)	300, 361
SinI	GGWCC	1 cut(s)	247
Sse9I	AATT	3 cut(s)	24, 134, 313
SsiI	CCGC	1 cut(s)	358
SspMI	CTAG	2 cut(s)	305, 399
StyD4I	CCNGG	1 cut(s)	75
TaaI	ACNGT	1 cut(s)	262
TasI	AATT	3 cut(s)	24, 134, 313
TfiI	GAWTC	3 cut(s)	19, 354, 403
Tru1I	TTAA	3 cut(s)	120, 140, 424
Tru9I	TTAA	3 cut(s)	120, 140, 424
TscAI	CASTG	3 cut(s)	21, 249, 335
TseI	GCWGC	1 cut(s)	86
TspDTI	ATGAA	1 cut(s)	306
TspRI	CASTG	3 cut(s)	21, 249, 335
VpaK11BI	GGWCC	1 cut(s)	247
XapI	RAATTY	1 cut(s)	313
XspI	CTAG	2 cut(s)	305, 399

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.