Rmu_sc0014837.1_g000001

leucine-rich repeat extensin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014837.1
Physical Location & Seq
Reverse (-)
3882 .. 7983
4102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014837.1_g000001.1.cds

Sequence Viewer

Length: 1293 bp
atgaagaagaagaccactctctttgatttttctcttcttctcctcactactgccttcttctttgcttctacactctcatcatccagccacattatcagccatggaagtctcaccgacgccgaggccctctacatcaagcagcggcagctgctctactaccgggacgagtccggcgaccggggagagatggtgaaagtagacccttctctggttttcgaaaacaagagactccgaaatgcttacatagcattgcaagcttggaaggaggctattctctccgaccctttcaatctcaccggggattgggtcggatctaatgtctgcaactacaccggagtgttctgtgcttcggcgcccgacaacagctcgatccgaaccgtcgccggcattgacctcaaccacggcgatattgctggctacttgccggaggagcttggtctgctcacagatctcgcattgttccacatcaattccaacaggttctgtgggactgtgccgcacaaattccggaacctgaagctgcttttcgagctggatatcagtaacaatcgatttgccggtaagttcccgcatgttgtgcttaagcttcctgagctgaaattcttggatctgaggttcaatgagttcgaggggactgtgcccaaggagctgtttgacaaggacctggatgctattttcatcaaccacaaccggttcaggttcgatctgccggataatttcgggaactcgccggtctccgtcatcgttctggccaacaacaagttccacggctgcgttccttccagcctgggcaacatgtccaacctgaaagagattattctgatgaacaatgggttcaggtcgtgcttgccggaggagattgggatgctgaagaacttgacggtgttcgacgtcagctacaatcagttcttgggttcgctgccggacacaattggagggatggtgagccttgagcagctcaatgtggctcataacttgctgtctgggtcgattccgccggctatttgcacgttgccgaggctggagaacttcacttactcttataacttcttcaccggcgagcctccggtgtgtctggccttgcctagtttcgatgacaagcggaattgcttgccgaataggccgtcacagaggtcggcggcgcaatgtaagtcgttcttgtctaagcctgtgaattgcaattcttttggttgtaagcctttcactccttcacctacaccctcaattcctgttccttcacctccggttgtgactccctcgccgccgggtcacagggtcacagggttggggtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

430

Amino Acids

47.64

Weight (kDa)

6.79

Isoelectric Point (pI)

44.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1044
AatII GACGTC 1 cut(s) 894
AccB1I GGYRCC 1 cut(s) 352
AccI GTMKAC 1 cut(s) 198
AccIII TCCGGA 1 cut(s) 507
AciI CCGC 7 cut(s) 142, 497, 569, 995, 1102, 1139, 1262
AclWI GGATC 3 cut(s) 319, 364, 615
AcoI YGGCCR 1 cut(s) 750
AcsI RAATTY 2 cut(s) 503, 599
AcuI CTGAAG 2 cut(s) 536, 890
AcyI GRCGYC 3 cut(s) 117, 353, 891
AfiI CCNNNNNNNGG 3 cut(s) 177, 208, 303
AflII CTTAAG 1 cut(s) 581
AflIII ACRYGT 1 cut(s) 795
AgeI ACCGGT 1 cut(s) 690
AgsI TTSAA 2 cut(s) 289, 619
AjnI CCWGG 2 cut(s) 663, 786
AjuI GAANNNNNNNTTGG 2 cut(s) 746, 778
AleI CACNNNNGTG 1 cut(s) 335
AloI GAACNNNNNNTCC 2 cut(s) 599, 631
Alw26I GTCTC 3 cut(s) 113, 220, 739
AlwI GGATC 3 cut(s) 319, 364, 615
AlwNI CAGNNNCTG 1 cut(s) 483
Aor13HI TCCGGA 1 cut(s) 507
AoxI GGCC 4 cut(s) 123, 750, 1077, 1121
ApeKI GCWGC 7 cut(s) 139, 145, 148, 520, 771, 919, 955
ApoI RAATTY 2 cut(s) 503, 599
ArsI GACNNNNNNTTYG 2 cut(s) 1109, 1141
AsiGI ACCGGT 1 cut(s) 690
AspLEI GCGC 2 cut(s) 355, 1144
AspS9I GGNCC 2 cut(s) 124, 661
AsuC2I CCSGG 4 cut(s) 161, 179, 298, 1266
AsuHPI GGTGA 7 cut(s) 103, 202, 286, 955, 1045, 1203, 1230
AsuII TTCGAA 1 cut(s) 216
AvaII GGWCC 1 cut(s) 661
BaeGI GKGCMC 1 cut(s) 642
BalI TGGCCA 1 cut(s) 752
BanI GGYRCC 1 cut(s) 352
BbsI GAAGAC 1 cut(s) 17
BbvI GCAGC 7 cut(s) 135, 151, 157, 507, 758, 906, 967
BccI CCATC 2 cut(s) 181, 934
BceAI ACGGC 3 cut(s) 418, 784, 1108
BciT130I CCWGG 2 cut(s) 665, 788
BcnI CCSGG 4 cut(s) 161, 179, 298, 1266
BcoDI GTCTC 3 cut(s) 113, 220, 739
BfaI CTAG 1 cut(s) 1086
BfoI RGCGCY 1 cut(s) 356
BfrI CTTAAG 1 cut(s) 581
BglI GCCNNNNNGGC 1 cut(s) 1120
BglII AGATCT 1 cut(s) 448
Bme1390I CCNGG 6 cut(s) 161, 179, 298, 665, 788, 1266
Bme18I GGWCC 1 cut(s) 661
BmgT120I GGNCC 2 cut(s) 124, 661
BmiI GGNNCC 2 cut(s) 354, 512
BmrFI CCNGG 6 cut(s) 161, 179, 298, 665, 788, 1266
BmsI GCATC 2 cut(s) 658, 855
BpiI GAAGAC 1 cut(s) 17
BpmI CTGGAG 1 cut(s) 1043
Bpu10I CCTNAGC 1 cut(s) 591
Bpu14I TTCGAA 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 971
BpuMI CCSGG 4 cut(s) 161, 179, 298, 1266
Bsa29I ATCGAT 1 cut(s) 550
BsaHI GRCGYC 3 cut(s) 117, 353, 891
BsaI GGTCTC 1 cut(s) 739
BsaJI CCNNGG 9 cut(s) 100, 120, 178, 297, 400, 642, 766, 787, 1016
BsaWI WCCGGW 5 cut(s) 332, 507, 690, 1066, 1243
BsaXI ACNNNNNCTCC 4 cut(s) 174, 204, 927, 957
Bsc4I CCNNNNNNNGG 3 cut(s) 177, 208, 303
Bse118I RCCGGY 6 cut(s) 383, 557, 690, 730, 997, 1055
Bse3DI GCAATG 2 cut(s) 248, 1151
BseAI TCCGGA 1 cut(s) 507
BseBI CCWGG 2 cut(s) 665, 788
BseCI ATCGAT 1 cut(s) 550
BseDI CCNNGG 9 cut(s) 100, 120, 178, 297, 400, 642, 766, 787, 1016
BseGI GGATG 4 cut(s) 80, 673, 870, 945
BseLI CCNNNNNNNGG 3 cut(s) 177, 208, 303
BseMI GCAATG 2 cut(s) 248, 1151
BseMII CTCAG 2 cut(s) 582, 602
BseRI GAGGAG 3 cut(s) 32, 443, 869
BseSI GKGCMC 1 cut(s) 642
BseXI GCAGC 7 cut(s) 135, 151, 157, 507, 758, 906, 967
Bsh1285I CGRYCG 1 cut(s) 178
BshFI GGCC 4 cut(s) 125, 752, 1079, 1123
BshNI GGYRCC 1 cut(s) 352
BshTI ACCGGT 1 cut(s) 690
BshVI ATCGAT 1 cut(s) 550
BsiEI CGRYCG 1 cut(s) 178
BslFI GGGAC 3 cut(s) 176, 502, 646
BslI CCNNNNNNNGG 3 cut(s) 177, 208, 303
BsmAI GTCTC 3 cut(s) 113, 220, 739
BsmFI GGGAC 3 cut(s) 176, 502, 646
BsnI GGCC 4 cut(s) 125, 752, 1079, 1123
Bso31I GGTCTC 1 cut(s) 739
Bsp119I TTCGAA 1 cut(s) 216
Bsp1286I GDGCHC 1 cut(s) 642
Bsp13I TCCGGA 1 cut(s) 507
Bsp143I GATC 5 cut(s) 311, 369, 448, 607, 703
Bsp19I CCATGG 1 cut(s) 100
BspACI CCGC 7 cut(s) 142, 497, 569, 995, 1102, 1139, 1262
BspANI GGCC 4 cut(s) 125, 752, 1079, 1123
BspCNI CTCAG 2 cut(s) 583, 603
BspDI ATCGAT 1 cut(s) 550
BspEI TCCGGA 1 cut(s) 507
BspLI GGNNCC 2 cut(s) 354, 512
BspPI GGATC 3 cut(s) 319, 364, 615
BspT104I TTCGAA 1 cut(s) 216
BspT107I GGYRCC 1 cut(s) 352
BspTI CTTAAG 1 cut(s) 581
BspTNI GGTCTC 1 cut(s) 739
BsrDI GCAATG 2 cut(s) 248, 1151
BsrFI RCCGGY 6 cut(s) 383, 557, 690, 730, 997, 1055
BssAI RCCGGY 6 cut(s) 383, 557, 690, 730, 997, 1055
BssECI CCNNGG 9 cut(s) 100, 120, 178, 297, 400, 642, 766, 787, 1016
BssMI GATC 5 cut(s) 311, 369, 448, 607, 703
BssNI GRCGYC 3 cut(s) 117, 353, 891
BssT1I CCWWGG 2 cut(s) 100, 642
Bst2UI CCWGG 2 cut(s) 665, 788
Bst4CI ACNGT 4 cut(s) 379, 493, 637, 883
Bst6I CTCTTC 1 cut(s) 39
BstACI GRCGYC 3 cut(s) 117, 353, 891
BstAFI CTTAAG 1 cut(s) 581
BstAPI GCANNNNNTGC 1 cut(s) 577
BstBI TTCGAA 1 cut(s) 216
BstC8I GCNNGC 7 cut(s) 255, 385, 415, 848, 999, 1061, 1112
BstDEI CTNAG 3 cut(s) 591, 611, 1164
BstDSI CCRYGG 3 cut(s) 100, 400, 766
BstF5I GGATG 4 cut(s) 80, 673, 870, 945
BstH2I RGCGCY 1 cut(s) 356
BstHHI GCGC 2 cut(s) 355, 1144
BstKTI GATC 5 cut(s) 314, 372, 451, 610, 706
BstMAI GTCTC 3 cut(s) 113, 220, 739
BstMBI GATC 5 cut(s) 311, 369, 448, 607, 703
BstMCI CGRYCG 1 cut(s) 178
BstNI CCWGG 2 cut(s) 665, 788
BstNSI RCATGY 2 cut(s) 575, 799
BstSCI CCNGG 6 cut(s) 159, 177, 296, 663, 786, 1264
BstSLI GKGCMC 1 cut(s) 642
BstV1I GCAGC 7 cut(s) 135, 151, 157, 507, 758, 906, 967
BstV2I GAAGAC 1 cut(s) 17
BstX2I RGATCY 3 cut(s) 311, 448, 607
BstYI RGATCY 3 cut(s) 311, 448, 607
Bsu15I ATCGAT 1 cut(s) 550
BsuRI GGCC 4 cut(s) 125, 752, 1079, 1123
BsuTUI ATCGAT 1 cut(s) 550
BtgI CCRYGG 3 cut(s) 100, 400, 766
BtsCI GGATG 4 cut(s) 80, 673, 870, 945
Cac8I GCNNGC 7 cut(s) 255, 385, 415, 848, 999, 1061, 1112
CaiI CAGNNNCTG 1 cut(s) 483
CfoI GCGC 2 cut(s) 355, 1144
Cfr10I RCCGGY 6 cut(s) 383, 557, 690, 730, 997, 1055
Cfr13I GGNCC 2 cut(s) 124, 661
ClaI ATCGAT 1 cut(s) 550
CseI GACGC 1 cut(s) 125
CspAI ACCGGT 1 cut(s) 690
CspCI CAANNNNNGTGG 2 cut(s) 4, 39
CviAII CATG 3 cut(s) 101, 572, 796
DdeI CTNAG 3 cut(s) 591, 611, 1164
DinI GGCGCC 1 cut(s) 354
DpnI GATC 5 cut(s) 313, 371, 450, 609, 705
DpnII GATC 5 cut(s) 311, 369, 448, 607, 703
EaeI YGGCCR 1 cut(s) 750
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
EciI GGCGGA 1 cut(s) 984
Eco130I CCWWGG 2 cut(s) 100, 642
Eco31I GGTCTC 1 cut(s) 739
Eco32I GATATC 1 cut(s) 538
Eco47I GGWCC 1 cut(s) 661
Eco57I CTGAAG 2 cut(s) 536, 890
EcoO109I RGGNCCY 2 cut(s) 124, 661
EcoRII CCWGG 2 cut(s) 663, 786
EcoRV GATATC 1 cut(s) 538
EcoT14I CCWWGG 2 cut(s) 100, 642
EgeI GGCGCC 1 cut(s) 354
EheI GGCGCC 1 cut(s) 354
ErhI CCWWGG 2 cut(s) 100, 642
FaeI CATG 3 cut(s) 104, 575, 799
FaiI YATR 6 cut(s) 102, 245, 573, 797, 972, 1044
FalI AAGNNNNNCTT 2 cut(s) 1142, 1174
FaqI GGGAC 3 cut(s) 176, 502, 646
FatI CATG 3 cut(s) 100, 571, 795
FauI CCCGC 1 cut(s) 576
FblI GTMKAC 1 cut(s) 198
FokI GGATG 4 cut(s) 67, 680, 877, 952
FspBI CTAG 1 cut(s) 1086
GlaI GCGC 2 cut(s) 354, 1143
GsuI CTGGAG 1 cut(s) 1043
HaeII RGCGCY 1 cut(s) 356
HaeIII GGCC 4 cut(s) 125, 752, 1079, 1123
HgaI GACGC 1 cut(s) 125
HhaI GCGC 2 cut(s) 355, 1144
Hin1I GRCGYC 3 cut(s) 117, 353, 891
Hin1II CATG 3 cut(s) 104, 575, 799
Hin6I GCGC 2 cut(s) 353, 1142
HinP1I GCGC 2 cut(s) 353, 1142
HindIII AAGCTT 2 cut(s) 255, 584
HinfI GANTC 4 cut(s) 167, 228, 991, 1252
HphI GGTGA 7 cut(s) 103, 202, 286, 955, 1045, 1203, 1230
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 6 cut(s) 233, 280, 311, 374, 612, 822
Hpy188III TCNNGA 3 cut(s) 508, 590, 721
Hpy8I GTNNAC 1 cut(s) 199
Hpy99I CGWCG 3 cut(s) 119, 383, 893
HpyAV CCTTC 6 cut(s) 64, 213, 256, 789, 1218, 1245
HpyCH4III ACNGT 4 cut(s) 379, 493, 637, 883
HpyCH4IV ACGT 2 cut(s) 891, 1010
HpyCH4V TGCA 4 cut(s) 253, 324, 1008, 1179
HpyF3I CTNAG 3 cut(s) 591, 611, 1164
HpySE526I ACGT 2 cut(s) 891, 1010
Hsp92I GRCGYC 3 cut(s) 117, 353, 891
Hsp92II CATG 3 cut(s) 104, 575, 799
HspAI GCGC 2 cut(s) 353, 1142
KasI GGCGCC 1 cut(s) 352
Kpn2I TCCGGA 1 cut(s) 507
KroI GCCGGC 2 cut(s) 383, 997
KroNI GCCGGC 2 cut(s) 385, 999
Kzo9I GATC 5 cut(s) 311, 369, 448, 607, 703
LmnI GCTCC 2 cut(s) 430, 646
Lsp1109I GCAGC 7 cut(s) 135, 151, 157, 507, 758, 906, 967
LweI GCATC 2 cut(s) 658, 855
MaeI CTAG 1 cut(s) 1086
MaeII ACGT 2 cut(s) 891, 1010
MaeIII GTNAC 5 cut(s) 542, 1125, 1249, 1268, 1276
MalI GATC 5 cut(s) 313, 371, 450, 609, 705
MboI GATC 5 cut(s) 311, 369, 448, 607, 703
MboII GAAGA 8 cut(s) 16, 19, 22, 26, 29, 49, 883, 1042
MfeI CAATTG 1 cut(s) 930
MflI RGATCY 3 cut(s) 311, 448, 607
MhlI GDGCHC 1 cut(s) 642
MlsI TGGCCA 1 cut(s) 752
MluCI AATT 9 cut(s) 469, 503, 599, 715, 930, 1105, 1174, 1180, 1224
MluNI TGGCCA 1 cut(s) 752
Mly113I GGCGCC 1 cut(s) 353
MlyI GAGTC 3 cut(s) 176, 222, 1246
MmeI TCCRAC 4 cut(s) 289, 303, 498, 825
Mox20I TGGCCA 1 cut(s) 752
MroI TCCGGA 1 cut(s) 507
MroNI GCCGGC 2 cut(s) 383, 997
MscI TGGCCA 1 cut(s) 752
MseI TTAA 1 cut(s) 582
MslI CAYNNNNRTG 1 cut(s) 335
Msp20I TGGCCA 1 cut(s) 752
MspA1I CMGCKG 2 cut(s) 142, 148
MspCI CTTAAG 1 cut(s) 581
MspR9I CCNGG 6 cut(s) 161, 179, 298, 665, 788, 1266
MunI CAATTG 1 cut(s) 930
MvaI CCWGG 2 cut(s) 665, 788
NaeI GCCGGC 2 cut(s) 385, 999
NarI GGCGCC 1 cut(s) 353
NciI CCSGG 4 cut(s) 161, 179, 298, 1266
NcoI CCATGG 1 cut(s) 100
NdeII GATC 5 cut(s) 311, 369, 448, 607, 703
NgoMIV GCCGGC 2 cut(s) 383, 997
NlaIII CATG 3 cut(s) 104, 575, 799
NlaIV GGNNCC 2 cut(s) 354, 512
NmeAIII GCCGAG 2 cut(s) 145, 1041
NmuCI GTSAC 4 cut(s) 1125, 1249, 1268, 1276
NspI RCATGY 2 cut(s) 575, 799
NspV TTCGAA 1 cut(s) 216
OliI CACNNNNGTG 1 cut(s) 335
PciI ACATGT 1 cut(s) 795
PcsI WCGNNNNNNNCGW 1 cut(s) 171
PdiI GCCGGC 2 cut(s) 385, 999
PfeI GAWTC 1 cut(s) 991
PinAI ACCGGT 1 cut(s) 690
PleI GAGTC 3 cut(s) 175, 222, 1246
PluTI GGCGCC 1 cut(s) 356
PpsI GAGTC 3 cut(s) 175, 222, 1246
PpuMI RGGWCCY 1 cut(s) 661
PscI ACATGT 1 cut(s) 795
PsiI TTATAA 1 cut(s) 1044
Psp5II RGGWCCY 1 cut(s) 661
Psp6I CCWGG 2 cut(s) 663, 786
PspGI CCWGG 2 cut(s) 663, 786
PspN4I GGNNCC 2 cut(s) 354, 512
PspPI GGNCC 2 cut(s) 124, 661
PspPPI RGGWCCY 1 cut(s) 661
PsrI GAACNNNNNNTAC 2 cut(s) 1019, 1051
PstNI CAGNNNCTG 1 cut(s) 483
PsuI RGATCY 3 cut(s) 311, 448, 607
PvuII CAGCTG 1 cut(s) 148
RseI CAYNNNNRTG 1 cut(s) 335
SaqAI TTAA 1 cut(s) 582
Sau3AI GATC 5 cut(s) 311, 369, 448, 607, 703
Sau96I GGNCC 2 cut(s) 124, 661
SchI GAGTC 3 cut(s) 176, 222, 1246
ScrFI CCNGG 6 cut(s) 161, 179, 298, 665, 788, 1266
SduI GDGCHC 1 cut(s) 642
SfaNI GCATC 2 cut(s) 658, 855
SfoI GGCGCC 1 cut(s) 354
SfuI TTCGAA 1 cut(s) 216
SgrAI CRCCGGYG 1 cut(s) 1055
SinI GGWCC 1 cut(s) 661
SmiMI CAYNNNNRTG 1 cut(s) 335
SmlI CTYRAG 2 cut(s) 581, 950
SmoI CTYRAG 2 cut(s) 581, 950
Sse9I AATT 9 cut(s) 469, 503, 599, 715, 930, 1105, 1174, 1180, 1224
SsiI CCGC 7 cut(s) 142, 497, 569, 995, 1102, 1139, 1262
SspDI GGCGCC 1 cut(s) 352
SspMI CTAG 1 cut(s) 1086
StyD4I CCNGG 6 cut(s) 159, 177, 296, 663, 786, 1264
StyI CCWWGG 2 cut(s) 100, 642
TaaI ACNGT 4 cut(s) 379, 493, 637, 883
TaiI ACGT 2 cut(s) 894, 1013
TaqI TCGA 9 cut(s) 216, 368, 528, 550, 627, 702, 888, 989, 1092
TasI AATT 9 cut(s) 469, 503, 599, 715, 930, 1105, 1174, 1180, 1224
TauI GCSGC 4 cut(s) 145, 499, 1142, 1264
TfiI GAWTC 1 cut(s) 991
Tru1I TTAA 1 cut(s) 582
Tru9I TTAA 1 cut(s) 582
TseFI GTSAC 4 cut(s) 1125, 1249, 1268, 1276
TseI GCWGC 7 cut(s) 139, 145, 148, 520, 771, 919, 955
Tsp45I GTSAC 4 cut(s) 1125, 1249, 1268, 1276
TspDTI ATGAA 3 cut(s) 17, 667, 839
TspGWI ACGGA 1 cut(s) 727
Vha464I CTTAAG 1 cut(s) 581
VpaK11BI GGWCC 1 cut(s) 661
XapI RAATTY 2 cut(s) 503, 599
XceI RCATGY 2 cut(s) 575, 799
XmiI GTMKAC 1 cut(s) 198
XspI CTAG 1 cut(s) 1086
ZraI GACGTC 1 cut(s) 892
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.