Rmu_sc0015540.1_g000001

Nudix hydrolase 15, mitochondrial-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015540.1
Physical Location & Seq
Reverse (-)
5605 .. 7218
1614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015540.1_g000001.1.cds

Sequence Viewer

Length: 795 bp
atgaacattgcaattggcctaaataataacatggcttatatagttcctccctctctgtgccaaacagaggatttgggaagcgaaaatctccgaaggcttgccaaacagcttcagttttacaaaccacccaaaccaattgacgaagtggaggaaaatattgagcatggcataaatgacgtgccttcttctgtaaaaatgagggagagaagagcagctgttctgatatgcctctttgaagatcctgaggatgagctaagagttattcttactagaagatcaatgaacttggcttcacatccaggtgatgtagcattgccaggtgggaaaatggaggagggagatgaagatgaatctgcaactgcactgagggaagccatggaagagattggcctagattctagtctagttcaagttgttgctcaactagagttctttttatctcagcacttgctcacagttgtccctgtaattggactcgtatcccggatagaagatttcaagcctctactcaacgctgacgaagttgatgcaatatttgatgtcccattggagatgtttctcaagaaagaaaatcacagatttgaggacagagaatggaggggatggaagtatgttgtccatcattttgatttcgaatccgagcaaggggagtttttaatatggggactaactgcaagcattctgattagagctgcctctgttatctaccaacaatctccattcttccaagcacatctccctgacttccaaactttgcaaagagccttgcatagtgttgactctaatgtagcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

264

Amino Acids

30.01

Weight (kDa)

4.72

Isoelectric Point (pI)

59.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 95
AfiI CCNNNNNNNGG 3 cut(s) 67, 470, 645
AgsI TTSAA 3 cut(s) 236, 410, 499
AjiI CACGTC 1 cut(s) 178
AjnI CCWGG 2 cut(s) 298, 316
AluBI AGCT 4 cut(s) 109, 215, 253, 692
AluI AGCT 4 cut(s) 109, 215, 253, 692
AlwI GGATC 1 cut(s) 233
AoxI GGCC 2 cut(s) 16, 388
ApeKI GCWGC 2 cut(s) 212, 692
AsuC2I CCSGG 1 cut(s) 484
AsuHPI GGTGA 1 cut(s) 314
AsuII TTCGAA 1 cut(s) 633
AxyI CCTNAGG 1 cut(s) 243
BbvI GCAGC 2 cut(s) 224, 679
BccI CCATC 2 cut(s) 597, 627
BcgI CGANNNNNNTGC 2 cut(s) 509, 543
BciT130I CCWGG 2 cut(s) 300, 318
BciVI GTATCC 1 cut(s) 490
BcnI CCSGG 1 cut(s) 484
BfaI CTAG 5 cut(s) 270, 392, 399, 404, 425
BfuI GTATCC 1 cut(s) 490
BisI GCNGC 2 cut(s) 213, 693
BlsI GCNGC 2 cut(s) 214, 694
Bme1390I CCNGG 3 cut(s) 300, 318, 484
BmgBI CACGTC 1 cut(s) 178
BmrFI CCNGG 3 cut(s) 300, 318, 484
BmsI GCATC 1 cut(s) 517
Bpu14I TTCGAA 1 cut(s) 633
BpuEI CTTGAG 1 cut(s) 545
BpuMI CCSGG 1 cut(s) 484
BsaJI CCNNGG 1 cut(s) 375
Bsc4I CCNNNNNNNGG 3 cut(s) 67, 470, 645
Bse21I CCTNAGG 1 cut(s) 243
Bse3DI GCAATG 2 cut(s) 6, 311
BseBI CCWGG 2 cut(s) 300, 318
BseDI CCNNGG 1 cut(s) 375
BseGI GGATG 3 cut(s) 253, 295, 608
BseLI CCNNNNNNNGG 3 cut(s) 67, 470, 645
BseMI GCAATG 2 cut(s) 6, 311
BseMII CTCAG 3 cut(s) 234, 356, 455
BseRI GAGGAG 1 cut(s) 347
BseXI GCAGC 2 cut(s) 224, 679
BsgI GTGCAG 1 cut(s) 345
BshFI GGCC 2 cut(s) 18, 390
BsiSI CCGG 1 cut(s) 484
BslFI GGGAC 3 cut(s) 446, 527, 678
BslI CCNNNNNNNGG 3 cut(s) 67, 470, 645
BsmFI GGGAC 3 cut(s) 446, 527, 678
BsmI GAATGC 1 cut(s) 678
BsnI GGCC 2 cut(s) 18, 390
Bsp119I TTCGAA 1 cut(s) 633
Bsp143I GATC 2 cut(s) 238, 275
Bsp19I CCATGG 1 cut(s) 375
BspANI GGCC 2 cut(s) 18, 390
BspCNI CTCAG 3 cut(s) 235, 357, 454
BspPI GGATC 1 cut(s) 233
BspQI GCTCTTC 1 cut(s) 202
BspT104I TTCGAA 1 cut(s) 633
BsrDI GCAATG 2 cut(s) 6, 311
BssECI CCNNGG 1 cut(s) 375
BssMI GATC 2 cut(s) 238, 275
BssT1I CCWWGG 1 cut(s) 375
Bst2UI CCWGG 2 cut(s) 300, 318
Bst4CI ACNGT 1 cut(s) 457
Bst6I CTCTTC 2 cut(s) 202, 375
BstBI TTCGAA 1 cut(s) 633
BstC8I GCNNGC 2 cut(s) 99, 676
BstDEI CTNAG 4 cut(s) 243, 254, 365, 441
BstDSI CCRYGG 1 cut(s) 375
BstF5I GGATG 3 cut(s) 253, 295, 608
BstKTI GATC 2 cut(s) 241, 278
BstMBI GATC 2 cut(s) 238, 275
BstNI CCWGG 2 cut(s) 300, 318
BstSCI CCNGG 3 cut(s) 298, 316, 482
BstV1I GCAGC 2 cut(s) 224, 679
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
Bsu36I CCTNAGG 1 cut(s) 243
BsuI GTATCC 1 cut(s) 490
BsuRI GGCC 2 cut(s) 18, 390
BtgI CCRYGG 1 cut(s) 375
BtrI CACGTC 1 cut(s) 178
BtsCI GGATG 3 cut(s) 253, 295, 608
BtsIMutI CAGTG 1 cut(s) 362
Cac8I GCNNGC 2 cut(s) 99, 676
CviAII CATG 4 cut(s) 31, 164, 376, 792
DdeI CTNAG 4 cut(s) 243, 254, 365, 441
DpnI GATC 2 cut(s) 240, 277
DpnII GATC 2 cut(s) 238, 275
Eam1104I CTCTTC 2 cut(s) 202, 375
EarI CTCTTC 2 cut(s) 202, 375
Eco130I CCWWGG 1 cut(s) 375
Eco57I CTGAAG 1 cut(s) 95
Eco81I CCTNAGG 1 cut(s) 243
EcoRII CCWGG 2 cut(s) 298, 316
EcoT14I CCWWGG 1 cut(s) 375
ErhI CCWWGG 1 cut(s) 375
FaeI CATG 4 cut(s) 34, 167, 379, 795
FaqI GGGAC 3 cut(s) 446, 527, 678
FatI CATG 4 cut(s) 30, 163, 375, 791
Fnu4HI GCNGC 2 cut(s) 213, 693
FokI GGATG 3 cut(s) 260, 282, 615
Fsp4HI GCNGC 2 cut(s) 213, 693
FspBI CTAG 5 cut(s) 270, 392, 399, 404, 425
GluI GCNGC 2 cut(s) 213, 693
HaeIII GGCC 2 cut(s) 18, 390
HapII CCGG 1 cut(s) 484
Hin1II CATG 4 cut(s) 34, 167, 379, 795
HincII GTYRAC 1 cut(s) 778
HindII GTYRAC 1 cut(s) 778
HinfI GANTC 5 cut(s) 350, 395, 474, 635, 779
HpaII CCGG 1 cut(s) 484
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 1 cut(s) 778
Hpy188I TCNGA 4 cut(s) 92, 222, 640, 684
Hpy188III TCNNGA 2 cut(s) 242, 562
Hpy8I GTNNAC 1 cut(s) 778
HpyAV CCTTC 2 cut(s) 87, 192
HpyCH4III ACNGT 1 cut(s) 457
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 7 cut(s) 11, 356, 362, 530, 674, 757, 769
HpyF3I CTNAG 4 cut(s) 243, 254, 365, 441
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 4 cut(s) 34, 167, 379, 795
Kzo9I GATC 2 cut(s) 238, 275
LguI GCTCTTC 1 cut(s) 202
LpnPI CCDG 8 cut(s) 255, 285, 303, 312, 330, 477, 497, 753
Lsp1109I GCAGC 2 cut(s) 224, 679
LweI GCATC 1 cut(s) 517
MaeI CTAG 5 cut(s) 270, 392, 399, 404, 425
MaeII ACGT 1 cut(s) 177
MalI GATC 2 cut(s) 240, 277
MboI GATC 2 cut(s) 238, 275
MboII GAAGA 8 cut(s) 177, 219, 248, 285, 356, 392, 503, 715
MfeI CAATTG 2 cut(s) 12, 135
MflI RGATCY 1 cut(s) 238
MluCI AATT 3 cut(s) 12, 135, 468
MlyI GAGTC 2 cut(s) 468, 773
MseI TTAA 1 cut(s) 656
MslI CAYNNNNRTG 1 cut(s) 300
MspA1I CMGCKG 1 cut(s) 215
MspI CCGG 1 cut(s) 484
MspR9I CCNGG 3 cut(s) 300, 318, 484
MunI CAATTG 2 cut(s) 12, 135
Mva1269I GAATGC 1 cut(s) 678
MvaI CCWGG 2 cut(s) 300, 318
NciI CCSGG 1 cut(s) 484
NcoI CCATGG 1 cut(s) 375
NdeII GATC 2 cut(s) 238, 275
NlaIII CATG 4 cut(s) 34, 167, 379, 795
NspV TTCGAA 1 cut(s) 633
PciSI GCTCTTC 1 cut(s) 202
PctI GAATGC 1 cut(s) 678
PfeI GAWTC 3 cut(s) 350, 395, 635
PfoI TCCNGGA 1 cut(s) 482
PkrI GCNGC 2 cut(s) 214, 694
PleI GAGTC 2 cut(s) 468, 773
PpsI GAGTC 2 cut(s) 468, 773
Psp6I CCWGG 2 cut(s) 298, 316
PspGI CCWGG 2 cut(s) 298, 316
PsuI RGATCY 1 cut(s) 238
PvuII CAGCTG 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 300
SapI GCTCTTC 1 cut(s) 202
SaqAI TTAA 1 cut(s) 656
SatI GCNGC 2 cut(s) 213, 693
Sau3AI GATC 2 cut(s) 238, 275
SchI GAGTC 2 cut(s) 468, 773
ScrFI CCNGG 3 cut(s) 300, 318, 484
SetI ASST 7 cut(s) 111, 180, 217, 255, 304, 322, 694
SfaNI GCATC 1 cut(s) 517
SfuI TTCGAA 1 cut(s) 633
SmiMI CAYNNNNRTG 1 cut(s) 300
SmlI CTYRAG 1 cut(s) 560
SmoI CTYRAG 1 cut(s) 560
Sse9I AATT 3 cut(s) 12, 135, 468
SspI AATATT 2 cut(s) 157, 534
SspMI CTAG 5 cut(s) 270, 392, 399, 404, 425
StyD4I CCNGG 3 cut(s) 298, 316, 482
StyI CCWWGG 1 cut(s) 375
TaaI ACNGT 1 cut(s) 457
TaiI ACGT 1 cut(s) 180
TaqI TCGA 1 cut(s) 633
TasI AATT 3 cut(s) 12, 135, 468
TfiI GAWTC 3 cut(s) 350, 395, 635
Tru1I TTAA 1 cut(s) 656
Tru9I TTAA 1 cut(s) 656
TscAI CASTG 1 cut(s) 369
TseI GCWGC 2 cut(s) 212, 692
TspDTI ATGAA 4 cut(s) 17, 296, 357, 363
TspRI CASTG 1 cut(s) 369
XspI CTAG 5 cut(s) 270, 392, 399, 404, 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.