Rmu_sc0016841.1_g000002

ELMO domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016841.1
Physical Location & Seq
Forward (+)
7518 .. 14904
7387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016841.1_g000002.1.cds

Sequence Viewer

Length: 597 bp
atggagattagagtaggtgaagggtgcagatcacgacgaattcagggaggagattgctgggatgcactaaaacaattatggaggttggcttatccggatagggagctcccacctcttaaatctgagctttggaaagatatgggttggcaaggtgcagacccttcaacagattttagaggtggagggtttatatcattggagaaccttatcttttttgcccaacaatatccggaatcattccatagactgttgcacaaacaagatggaacccgagctgaatgggaatatcctttcgctgtagctggaatcaatatttcatttgtcttggcacaaatgttggatcttcaatcagcaaagccaacttcgttggcaggaatccgattcctacaactgctccaagaagacgaaatggcatttgataacctatattgtgtaaccttccaaatgatggatgctcaatggcttgcgaagcgtgcttcgtatatggagttcaatgatgttatgaagtctacaacaactcagctagagcgtgagcttgccctcgaagatgtcaccagcgttaaagatttaccagcatacaatctattggcaaaatga

Protein Analysis

198

Amino Acids

22.8

Weight (kDa)

4.93

Isoelectric Point (pI)

48.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 448
AccI GTMKAC 1 cut(s) 509
AccIII TCCGGA 2 cut(s) 94, 229
AclWI GGATC 1 cut(s) 348
AcsI RAATTY 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 448
AgsI TTSAA 3 cut(s) 165, 347, 493
AluBI AGCT 6 cut(s) 106, 127, 275, 302, 523, 535
AluI AGCT 6 cut(s) 106, 127, 275, 302, 523, 535
Alw21I GWGCWC 1 cut(s) 108
AlwI GGATC 1 cut(s) 348
Ama87I CYCGRG 1 cut(s) 270
Aor13HI TCCGGA 2 cut(s) 94, 229
ApoI RAATTY 1 cut(s) 39
AsuHPI GGTGA 2 cut(s) 29, 544
AvaI CYCGRG 1 cut(s) 270
BanII GRGCYC 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 408
Bbv12I GWGCWC 1 cut(s) 108
BccI CCATC 2 cut(s) 257, 442
BfaI CTAG 1 cut(s) 524
BfmI CTRYAG 1 cut(s) 297
BmeT110I CYCGRG 1 cut(s) 270
BmiI GGNNCC 1 cut(s) 268
BmsI GCATC 2 cut(s) 52, 442
BpiI GAAGAC 1 cut(s) 408
BsaWI WCCGGW 2 cut(s) 94, 229
BsaXI ACNNNNNCTCC 2 cut(s) 378, 408
Bsc4I CCNNNNNNNGG 1 cut(s) 448
BseAI TCCGGA 2 cut(s) 94, 229
BseGI GGATG 2 cut(s) 67, 457
BseLI CCNNNNNNNGG 1 cut(s) 448
BseMII CTCAG 2 cut(s) 114, 533
BseRI GAGGAG 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 57
BsgI GTGCAG 2 cut(s) 46, 174
BsiHKAI GWGCWC 1 cut(s) 108
BsiHKCI CYCGRG 1 cut(s) 270
BsiSI CCGG 2 cut(s) 95, 230
BslI CCNNNNNNNGG 1 cut(s) 448
BsoBI CYCGRG 1 cut(s) 270
Bsp1286I GDGCHC 1 cut(s) 108
Bsp13I TCCGGA 2 cut(s) 94, 229
Bsp143I GATC 2 cut(s) 29, 340
BspCNI CTCAG 2 cut(s) 115, 532
BspEI TCCGGA 2 cut(s) 94, 229
BspLI GGNNCC 1 cut(s) 268
BspPI GGATC 1 cut(s) 348
BssMI GATC 2 cut(s) 29, 340
Bst4CI ACNGT 1 cut(s) 249
BstC8I GCNNGC 3 cut(s) 465, 474, 537
BstDEI CTNAG 2 cut(s) 123, 519
BstF5I GGATG 2 cut(s) 67, 457
BstKTI GATC 2 cut(s) 32, 343
BstMBI GATC 2 cut(s) 29, 340
BstMWI GCNNNNNNNGC 2 cut(s) 469, 473
BstSFI CTRYAG 1 cut(s) 297
BstV2I GAAGAC 1 cut(s) 408
BstX2I RGATCY 1 cut(s) 340
BstYI RGATCY 1 cut(s) 340
BtsCI GGATG 2 cut(s) 67, 457
Cac8I GCNNGC 3 cut(s) 465, 474, 537
CviJI RGCY 9 cut(s) 89, 106, 127, 275, 302, 358, 463, 523, 535
CviKI_1 RGCY 9 cut(s) 89, 106, 127, 275, 302, 358, 463, 523, 535
DdeI CTNAG 2 cut(s) 123, 519
DpnI GATC 2 cut(s) 31, 342
DpnII GATC 2 cut(s) 29, 340
Ecl136II GAGCTC 1 cut(s) 106
Eco24I GRGCYC 1 cut(s) 108
Eco53kI GAGCTC 1 cut(s) 106
Eco88I CYCGRG 1 cut(s) 270
EcoICRI GAGCTC 1 cut(s) 106
EcoRI GAATTC 1 cut(s) 39
EcoT38I GRGCYC 1 cut(s) 108
FaiI YATR 9 cut(s) 79, 140, 191, 243, 427, 483, 485, 503, 577
FblI GTMKAC 1 cut(s) 509
FokI GGATG 2 cut(s) 74, 464
FriOI GRGCYC 1 cut(s) 108
FspBI CTAG 1 cut(s) 524
GsaI CCCAGC 1 cut(s) 61
HapII CCGG 2 cut(s) 95, 230
HinfI GANTC 4 cut(s) 233, 306, 375, 381
HpaII CCGG 2 cut(s) 95, 230
HphI GGTGA 2 cut(s) 29, 544
Hpy166II GTNNAC 1 cut(s) 510
Hpy188I TCNGA 2 cut(s) 124, 380
Hpy188III TCNNGA 3 cut(s) 33, 95, 230
Hpy8I GTNNAC 1 cut(s) 510
Hpy99I CGWCG 1 cut(s) 39
HpyAV CCTTC 3 cut(s) 14, 171, 448
HpyCH4III ACNGT 1 cut(s) 249
HpyCH4V TGCA 4 cut(s) 27, 65, 155, 253
HpyF10VI GCNNNNNNNGC 2 cut(s) 469, 473
HpyF3I CTNAG 2 cut(s) 123, 519
Kpn2I TCCGGA 2 cut(s) 94, 229
Kzo9I GATC 2 cut(s) 29, 340
LmnI GCTCC 3 cut(s) 103, 111, 399
LpnPI CCDG 8 cut(s) 29, 43, 108, 243, 288, 357, 568, 585
LweI GCATC 2 cut(s) 52, 442
MaeI CTAG 1 cut(s) 524
MaeIII GTNAC 2 cut(s) 433, 550
MalI GATC 2 cut(s) 31, 342
MboI GATC 2 cut(s) 29, 340
MboII GAAGA 3 cut(s) 335, 413, 557
MflI RGATCY 1 cut(s) 340
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 2 cut(s) 39, 74
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 6 cut(s) 41, 75, 123, 170, 176, 551
MroI TCCGGA 2 cut(s) 94, 229
MseI TTAA 2 cut(s) 117, 561
MspI CCGG 2 cut(s) 95, 230
MwoI GCNNNNNNNGC 2 cut(s) 469, 473
NdeII GATC 2 cut(s) 29, 340
NlaIV GGNNCC 1 cut(s) 268
NmuCI GTSAC 1 cut(s) 550
PfeI GAWTC 4 cut(s) 233, 306, 375, 381
PflMI CCANNNNNTGG 1 cut(s) 448
Psp124BI GAGCTC 1 cut(s) 108
PspFI CCCAGC 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 268
PsrI GAACNNNNNNTAC 2 cut(s) 473, 505
PsuI RGATCY 1 cut(s) 340
SacI GAGCTC 1 cut(s) 108
SaqAI TTAA 2 cut(s) 117, 561
Sau3AI GATC 2 cut(s) 29, 340
SduI GDGCHC 1 cut(s) 108
SfaNI GCATC 2 cut(s) 52, 442
SfcI CTRYAG 1 cut(s) 297
Sse9I AATT 2 cut(s) 39, 74
SspI AATATT 1 cut(s) 313
SspMI CTAG 1 cut(s) 524
SstI GAGCTC 1 cut(s) 108
TaaI ACNGT 1 cut(s) 249
TaqI TCGA 1 cut(s) 543
TasI AATT 2 cut(s) 39, 74
TfiI GAWTC 4 cut(s) 233, 306, 375, 381
Tru1I TTAA 2 cut(s) 117, 561
Tru9I TTAA 2 cut(s) 117, 561
TseFI GTSAC 1 cut(s) 550
Tsp45I GTSAC 1 cut(s) 550
TspDTI ATGAA 2 cut(s) 306, 518
Van91I CCANNNNNTGG 1 cut(s) 448
XapI RAATTY 1 cut(s) 39
XmiI GTMKAC 1 cut(s) 509
XspI CTAG 1 cut(s) 524
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.