Rmu_sc0017774.1_g000002

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017774.1
Physical Location & Seq
Reverse (-)
15419 .. 15724
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017774.1_g000002.1.cds

Sequence Viewer

Length: 306 bp
atggcgaggatgctagtggggaacaaatgtgatttggagaatattagggatgtgagtgttgaagaaggtaaaagccttgctgaagccgaagggttgttcttcatggagacatctgcgctagattcaaccaatgttaataaggcttttgagcttgttattcgagaaatatatagcaatgtgagtcggaaggtcttgaattcagatacttacaaagcagagttatctgtgaacagagtaaccctggttaataatggggcagatggatccaagaaagcccagggctacttttcttgctgttccagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.08

Weight (kDa)

5.12

Isoelectric Point (pI)

24.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012896)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 258, 271
AcsI RAATTY 1 cut(s) 196
AcuI CTGAAG 1 cut(s) 102
AgsI TTSAA 3 cut(s) 62, 126, 196
AjnI CCWGG 2 cut(s) 240, 276
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
Alw26I GTCTC 1 cut(s) 101
AlwI GGATC 2 cut(s) 258, 271
ApoI RAATTY 1 cut(s) 196
AspLEI GCGC 1 cut(s) 118
BamHI GGATCC 1 cut(s) 263
BccI CCATC 1 cut(s) 254
BciT130I CCWGG 2 cut(s) 242, 278
BcoDI GTCTC 1 cut(s) 101
BfaI CTAG 2 cut(s) 14, 119
Bme1390I CCNGG 2 cut(s) 242, 278
BmiI GGNNCC 1 cut(s) 265
BmrFI CCNGG 2 cut(s) 242, 278
BsaJI CCNNGG 3 cut(s) 240, 276, 277
Bse1I ACTGG 1 cut(s) 300
Bse3DI GCAATG 1 cut(s) 181
BseBI CCWGG 2 cut(s) 242, 278
BseDI CCNNGG 3 cut(s) 240, 276, 277
BseGI GGATG 2 cut(s) 15, 55
BseMI GCAATG 1 cut(s) 181
BseNI ACTGG 1 cut(s) 300
BsmAI GTCTC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 263
BspLI GGNNCC 1 cut(s) 265
BspPI GGATC 2 cut(s) 258, 271
BsrDI GCAATG 1 cut(s) 181
BsrI ACTGG 1 cut(s) 300
BssECI CCNNGG 3 cut(s) 240, 276, 277
BssMI GATC 1 cut(s) 263
Bst2UI CCWGG 2 cut(s) 242, 278
BstF5I GGATG 2 cut(s) 15, 55
BstHHI GCGC 1 cut(s) 118
BstKTI GATC 1 cut(s) 266
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 1 cut(s) 263
BstNI CCWGG 2 cut(s) 242, 278
BstSCI CCNGG 2 cut(s) 240, 276
BstX2I RGATCY 1 cut(s) 263
BstYI RGATCY 1 cut(s) 263
BtsCI GGATG 2 cut(s) 15, 55
CfoI GCGC 1 cut(s) 118
CviAII CATG 1 cut(s) 103
CviJI RGCY 6 cut(s) 75, 86, 143, 151, 275, 282
CviKI_1 RGCY 6 cut(s) 75, 86, 143, 151, 275, 282
DpnI GATC 1 cut(s) 265
DpnII GATC 1 cut(s) 263
Eco57I CTGAAG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 196
EcoRII CCWGG 2 cut(s) 240, 276
FaeI CATG 1 cut(s) 106
FaiI YATR 3 cut(s) 104, 169, 171
FatI CATG 1 cut(s) 102
FokI GGATG 2 cut(s) 22, 62
FspBI CTAG 2 cut(s) 14, 119
GlaI GCGC 1 cut(s) 117
HhaI GCGC 1 cut(s) 118
Hin1II CATG 1 cut(s) 106
Hin6I GCGC 1 cut(s) 116
HinP1I GCGC 1 cut(s) 116
HinfI GANTC 2 cut(s) 122, 181
Hpy166II GTNNAC 1 cut(s) 229
Hpy188I TCNGA 2 cut(s) 186, 202
Hpy188III TCNNGA 2 cut(s) 161, 193
Hpy8I GTNNAC 1 cut(s) 229
HpyAV CCTTC 3 cut(s) 59, 83, 181
Hsp92II CATG 1 cut(s) 106
HspAI GCGC 1 cut(s) 116
Kzo9I GATC 1 cut(s) 263
LpnPI CCDG 4 cut(s) 227, 254, 263, 290
MaeI CTAG 2 cut(s) 14, 119
MaeIII GTNAC 1 cut(s) 235
MalI GATC 1 cut(s) 265
MboI GATC 1 cut(s) 263
MboII GAAGA 2 cut(s) 74, 91
MflI RGATCY 1 cut(s) 263
MluCI AATT 1 cut(s) 196
MlyI GAGTC 1 cut(s) 190
MmeI TCCRAC 1 cut(s) 164
MseI TTAA 3 cut(s) 135, 246, 304
MspR9I CCNGG 2 cut(s) 242, 278
MvaI CCWGG 2 cut(s) 242, 278
NdeII GATC 1 cut(s) 263
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 265
PasI CCCWGGG 1 cut(s) 277
PfeI GAWTC 1 cut(s) 122
PleI GAGTC 1 cut(s) 189
PpsI GAGTC 1 cut(s) 189
Psp6I CCWGG 2 cut(s) 240, 276
PspGI CCWGG 2 cut(s) 240, 276
PspN4I GGNNCC 1 cut(s) 265
PsuI RGATCY 1 cut(s) 263
SaqAI TTAA 3 cut(s) 135, 246, 304
Sau3AI GATC 1 cut(s) 263
SchI GAGTC 1 cut(s) 190
ScrFI CCNGG 2 cut(s) 242, 278
SetI ASST 3 cut(s) 70, 153, 192
Sse9I AATT 1 cut(s) 196
SspI AATATT 1 cut(s) 43
SspMI CTAG 2 cut(s) 14, 119
StyD4I CCNGG 2 cut(s) 240, 276
TaqI TCGA 1 cut(s) 160
TasI AATT 1 cut(s) 196
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 3 cut(s) 135, 246, 304
Tru9I TTAA 3 cut(s) 135, 246, 304
TspDTI ATGAA 1 cut(s) 91
XapI RAATTY 1 cut(s) 196
XspI CTAG 2 cut(s) 14, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.