Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022064.1

Orthogroup ID

OG0006671

Physical Location & Seq

Genomic Coordinates Forward (+)

6742 .. 9654

Gene Structure 2913 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022064.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1908 bp

atgcaatatttccaaaccctgaagaggagcaagctcatcattaacagcagagaagcagagcagagctgcttggctctactccaactgtgcgacgtcgttccgaagctgacgcaaatccaagcccacattgtcaaattgggcctccgaaacaaccccttagtgctgacaaagttcgcctccaccgcctccgacctcaaggccattgaccacgcctcttccttcctgttctcgccggattccgatacccatttattcgatgcgtttctcttcaacaccgtcatcagggcttacgctcagaccggtcatgcaaagcataaagctttgtgcttttacagagttatggttaaaggtgaagtcttgcctaataaattcacctacccttttgttctcaaggcctgtgccggagttggggacttgaatttggggaagtcggttcatgggtcggtggtgaaattcgggtttggtgatgatgtccatgttcggaacaccatggttcatatgtactgttgctgcggtggagggattgaaagtgcacggaaggtgttcgatgaaatgcctaactgggactctgtttcgtggagcgcgatgattggagggtatgtgagggtggggtggtctagtgatgcggtggagttgtttagggagatgcagatggcgggagtgaggccggacgagattactatggtttcggttttgtctgcgtgtaccgatttgggtgcgcttgagcttggcaagtgggtggagtcctatattgagaaagaggggattcagaaaagtgtggagctttgtaatgcgctcattgacatgtttgcgaaatgtggcaatgttgataaggctttgaagttgtttaggggcatgagtgggagaacaattgtttcttggacttctgtgattgatggtttggcaatgcatggccgcggagaagaggccgtttctttgtttgaggaaatgattggagtcggggtggaaccggatgatgttgcatttataggactgctttcggcttgtagtcattccgggttggtcgataagggaaagaggtacttcagttcaatgatggaaaaatttggacgtgtacctaagatcgaacactatgggtgcatggtggatatgttatgccgagctggacatgtcaaggaggcattggagtttattcggaaaatgcctattcagccaaatccaatagttttgcgaaccctgatcagtgcttgccgtgtgcatggtgagctcaagcttggagagagcatcaccaaggagttaatcagggctgaacctatgcatgagtcgaactatgtcctgctttccaacatctatgcaaaaatgaaccattgggagaagaaaaccaagactagagaggcgatggacaagaaagggatgaaaaagatccctgggagcactatgattgagcaagataatgaaatttacgaatttgtggcaggggataaatcgcataaacagtccaaagagatttatgaaatggttgatgaaatggggaggaagatgaagacggctggatatgttcccactacatcagaggttttgctagacattgatgaagaagataaagaagatgctttaaataggcatagtgaaaagttggccattgctttcgccctcctgaacacgccaccaggaactcctattcgcatagtaaagaatctgcggcaagcgagacagtctccgctcagcgcaacaccgctagtggaacttctctatcttcatcttgcaagcgagacagtctccgctcagcgcaacaccgctagcggaacttctctcttttcatctggcaagcgagtttccgctcagcgcaacaccgctagcggaacttctctcctccaccttgcaggcaaggtccccgcaacgcatcttaccgctgactttcagcgaagagacttctgccaacagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2 PPR_3

Protein Analysis

635

Amino Acids

70.51

Weight (kDa)

8.23

Isoelectric Point (pI)

39.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006671)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G31920
fragaria_vesca	FvH4_2g29361 FvH4_5g23310
malus_domestica	MD08G1148200.v1.1
prunus_persica	Prupe.1G479200_v2.0.a1 Prupe.5G026200_v2.0.a1
pyrus_communis	pycom08g12480
rosa_chinensis	RchiOBHm_Chr6g0298171 RchiOBHm_Chr7g0212261
rosa_laevigata	RLG00000002902 RLG00000011529
rosa_multiflora	Rmu_co8497291.1_g000001 Rmu_sc0001911.1_g000044 Rmu_sc0002882.1_g000068 Rmu_sc0007429.1_g000004 Rmu_sc0010099.1_g000013 Rmu_sc0022064.1_g000003
rosa_roxburghii	Rroxscaffold_3G00246970
rosa_rugosa	Rorug06G0279100 Rorug07G0132900
rosa_samantha	Rh6AG389400 Rh6DG390300 Rh7BG259900
rosa_wichuraiana	Rw0G010650 Rw6G034000 Rw7G022750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	96
AccBSI	CCGCTC	3 cut(s)	1684, 1745, 1802
AccII	CGCG	2 cut(s)	584, 918
AclWI	GGATC	1 cut(s)	1378
AcoI	YGGCCR	2 cut(s)	913, 1599
AcsI	RAATTY	6 cut(s)	368, 418, 452, 1064, 1419, 1427
AcuI	CTGAAG	2 cut(s)	41, 1030
AcyI	GRCGYC	1 cut(s)	93
AfaI	GTAC	4 cut(s)	503, 706, 1043, 1077
AfiI	CCNNNNNNNGG	3 cut(s)	24, 282, 408
AflIII	ACRYGT	3 cut(s)	804, 1072, 1129
AgeI	ACCGGT	1 cut(s)	299
AgsI	TTSAA	5 cut(s)	271, 418, 527, 841, 1053
AjiI	CACGTC	1 cut(s)	1073
AjnI	CCWGG	2 cut(s)	1387, 1630
AluBI	AGCT	9 cut(s)	34, 66, 106, 320, 727, 784, 1124, 1228, 1234
AluI	AGCT	9 cut(s)	34, 66, 106, 320, 727, 784, 1124, 1228, 1234
Alw21I	GWGCWC	3 cut(s)	535, 1230, 1397
Alw26I	GTCTC	5 cut(s)	1666, 1683, 1727, 1744, 1884
Alw44I	GTGCAC	1 cut(s)	531
AlwI	GGATC	1 cut(s)	1378
AoxI	GGCC	7 cut(s)	139, 198, 393, 665, 913, 927, 1599
ApaLI	GTGCAC	1 cut(s)	531
ApeKI	GCWGC	2 cut(s)	66, 510
ApoI	RAATTY	6 cut(s)	368, 418, 452, 1064, 1419, 1427
AsiGI	ACCGGT	1 cut(s)	299
Asp700I	GAANNNNTTC	1 cut(s)	542
AspLEI	GCGC	6 cut(s)	584, 721, 796, 1691, 1752, 1809
AspS9I	GGNCC	2 cut(s)	139, 1852
AsuC2I	CCSGG	1 cut(s)	1018
AsuHPI	GGTGA	6 cut(s)	362, 364, 460, 476, 1235, 1240
AsuNHI	GCTAGC	2 cut(s)	1760, 1817
AvaII	GGWCC	1 cut(s)	1852
BaeGI	GKGCMC	1 cut(s)	535
BaeI	ACNNNNGTAYC	2 cut(s)	1033, 1066
BalI	TGGCCA	1 cut(s)	1601
BanII	GRGCYC	1 cut(s)	1230
BbsI	GAAGAC	1 cut(s)	1511
Bbv12I	GWGCWC	3 cut(s)	535, 1230, 1397
BbvI	GCAGC	2 cut(s)	53, 497
BccI	CCATC	4 cut(s)	646, 890, 1051, 1354
BceAI	ACGGC	3 cut(s)	914, 1197, 1524
BcgI	CGANNNNNNTGC	2 cut(s)	698, 732
BciT130I	CCWGG	2 cut(s)	1389, 1632
BclI	TGATCA	1 cut(s)	1200
BcnI	CCSGG	1 cut(s)	1018
BcoDI	GTCTC	5 cut(s)	1666, 1683, 1727, 1744, 1884
BfaI	CTAG	6 cut(s)	618, 1350, 1544, 1700, 1761, 1818
BisI	GCNGC	4 cut(s)	67, 511, 916, 1664
BlpI	GCTNAGC	3 cut(s)	1685, 1746, 1803
BlsI	GCNGC	4 cut(s)	68, 512, 917, 1665
Bme1390I	CCNGG	3 cut(s)	1018, 1389, 1632
Bme18I	GGWCC	1 cut(s)	1852
BmgBI	CACGTC	1 cut(s)	1073
BmgT120I	GGNCC	2 cut(s)	139, 1852
BmiI	GGNNCC	2 cut(s)	969, 1854
BmrFI	CCNGG	3 cut(s)	1018, 1389, 1632
BmrI	ACTGGG	1 cut(s)	571
BmsI	GCATC	6 cut(s)	247, 613, 636, 1254, 1561, 1873
BmtI	GCTAGC	2 cut(s)	1764, 1821
BmuI	ACTGGG	1 cut(s)	571
BpiI	GAAGAC	1 cut(s)	1511
BplI	GAGNNNNNCTC	4 cut(s)	1663, 1695, 1724, 1756
Bpu1102I	GCTNAGC	3 cut(s)	1685, 1746, 1803
BpuEI	CTTGAG	4 cut(s)	179, 374, 743, 1214
BpuMI	CCSGG	1 cut(s)	1018
BsaHI	GRCGYC	1 cut(s)	93
BsaJI	CCNNGG	5 cut(s)	489, 916, 1251, 1387, 1388
BsaWI	WCCGGW	2 cut(s)	299, 970
BsaXI	ACNNNNNCTCC	4 cut(s)	585, 615, 948, 978
Bsc4I	CCNNNNNNNGG	3 cut(s)	24, 282, 408
Bse118I	RCCGGY	1 cut(s)	299
Bse1I	ACTGG	1 cut(s)	566
Bse3DI	GCAATG	3 cut(s)	829, 912, 1602
BseBI	CCWGG	2 cut(s)	1389, 1632
BseDI	CCNNGG	5 cut(s)	489, 916, 1251, 1387, 1388
BseGI	GGATG	2 cut(s)	979, 1380
BseLI	CCNNNNNNNGG	3 cut(s)	24, 282, 408
BseMI	GCAATG	3 cut(s)	829, 912, 1602
BseMII	CTCAG	4 cut(s)	308, 1699, 1760, 1817
BseNI	ACTGG	1 cut(s)	566
BseRI	GAGGAG	2 cut(s)	40, 1823
BseSI	GKGCMC	1 cut(s)	535
BseXI	GCAGC	2 cut(s)	53, 497
Bsh1236I	CGCG	2 cut(s)	584, 918
BshFI	GGCC	7 cut(s)	141, 200, 395, 667, 915, 929, 1601
BshTI	ACCGGT	1 cut(s)	299
BsiHKAI	GWGCWC	3 cut(s)	535, 1230, 1397
BsiSI	CCGG	6 cut(s)	233, 300, 402, 668, 971, 1017
BslFI	GGGAC	3 cut(s)	425, 578, 1838
BslI	CCNNNNNNNGG	3 cut(s)	24, 282, 408
BsmAI	GTCTC	5 cut(s)	1666, 1683, 1727, 1744, 1884
BsmFI	GGGAC	3 cut(s)	425, 578, 1838
BsnI	GGCC	7 cut(s)	141, 200, 395, 667, 915, 929, 1601
Bsp1286I	GDGCHC	3 cut(s)	535, 1230, 1397
Bsp143I	GATC	3 cut(s)	1083, 1200, 1383
Bsp1720I	GCTNAGC	3 cut(s)	1685, 1746, 1803
Bsp19I	CCATGG	1 cut(s)	489
BspANI	GGCC	7 cut(s)	141, 200, 395, 667, 915, 929, 1601
BspCNI	CTCAG	4 cut(s)	307, 1698, 1759, 1816
BspFNI	CGCG	2 cut(s)	584, 918
BspLI	GGNNCC	2 cut(s)	969, 1854
BspOI	GCTAGC	2 cut(s)	1764, 1821
BspPI	GGATC	1 cut(s)	1378
BsrBI	CCGCTC	3 cut(s)	1684, 1745, 1802
BsrDI	GCAATG	3 cut(s)	829, 912, 1602
BsrFI	RCCGGY	1 cut(s)	299
BsrI	ACTGG	1 cut(s)	566
BssAI	RCCGGY	1 cut(s)	299
BssECI	CCNNGG	5 cut(s)	489, 916, 1251, 1387, 1388
BssMI	GATC	3 cut(s)	1083, 1200, 1383
BssNI	GRCGYC	1 cut(s)	93
BssT1I	CCWWGG	2 cut(s)	489, 1251
Bst2UI	CCWGG	2 cut(s)	1389, 1632
Bst4CI	ACNGT	7 cut(s)	87, 277, 506, 1458, 1677, 1738, 1905
Bst6I	CTCTTC	5 cut(s)	17, 220, 272, 918, 1882
BstACI	GRCGYC	1 cut(s)	93
BstC8I	GCNNGC	8 cut(s)	32, 1210, 1668, 1729, 1762, 1790, 1819, 1846
BstDEI	CTNAG	6 cut(s)	157, 294, 1080, 1685, 1746, 1803
BstDSI	CCRYGG	2 cut(s)	489, 916
BstF5I	GGATG	2 cut(s)	979, 1380
BstFNI	CGCG	2 cut(s)	584, 918
BstHHI	GCGC	6 cut(s)	584, 721, 796, 1691, 1752, 1809
BstKTI	GATC	3 cut(s)	1086, 1203, 1386
BstMAI	GTCTC	5 cut(s)	1666, 1683, 1727, 1744, 1884
BstMBI	GATC	3 cut(s)	1083, 1200, 1383
BstMWI	GCNNNNNNNGC	3 cut(s)	182, 1171, 1225
BstNI	CCWGG	2 cut(s)	1389, 1632
BstNSI	RCATGY	2 cut(s)	808, 1133
BstSCI	CCNGG	3 cut(s)	1016, 1387, 1630
BstSLI	GKGCMC	1 cut(s)	535
BstUI	CGCG	2 cut(s)	584, 918
BstV1I	GCAGC	2 cut(s)	53, 497
BstV2I	GAAGAC	1 cut(s)	1511
BstX2I	RGATCY	1 cut(s)	1383
BstYI	RGATCY	1 cut(s)	1383
BsuRI	GGCC	7 cut(s)	141, 200, 395, 667, 915, 929, 1601
BtgI	CCRYGG	2 cut(s)	489, 916
BtgZI	GCGATG	2 cut(s)	599, 1373
BtrI	CACGTC	1 cut(s)	1073
BtsCI	GGATG	2 cut(s)	979, 1380
BtsIMutI	CAGTG	1 cut(s)	1210
Cac8I	GCNNGC	8 cut(s)	32, 1210, 1668, 1729, 1762, 1790, 1819, 1846
CfoI	GCGC	6 cut(s)	584, 721, 796, 1691, 1752, 1809
Cfr10I	RCCGGY	1 cut(s)	299
Cfr13I	GGNCC	2 cut(s)	139, 1852
Cfr42I	CCGCGG	1 cut(s)	919
CseI	GACGC	1 cut(s)	118
Csp6I	GTAC	4 cut(s)	502, 705, 1042, 1076
CspAI	ACCGGT	1 cut(s)	299
CviQI	GTAC	4 cut(s)	502, 705, 1042, 1076
DdeI	CTNAG	6 cut(s)	157, 294, 1080, 1685, 1746, 1803
DpnI	GATC	3 cut(s)	1085, 1202, 1385
DpnII	GATC	3 cut(s)	1083, 1200, 1383
DraI	TTTAAA	1 cut(s)	1578
EaeI	YGGCCR	2 cut(s)	913, 1599
Eam1104I	CTCTTC	5 cut(s)	17, 220, 272, 918, 1882
EarI	CTCTTC	5 cut(s)	17, 220, 272, 918, 1882
Ecl136II	GAGCTC	1 cut(s)	1228
Eco130I	CCWWGG	2 cut(s)	489, 1251
Eco147I	AGGCCT	1 cut(s)	395
Eco24I	GRGCYC	1 cut(s)	1230
Eco47I	GGWCC	1 cut(s)	1852
Eco53kI	GAGCTC	1 cut(s)	1228
Eco57I	CTGAAG	2 cut(s)	41, 1030
EcoICRI	GAGCTC	1 cut(s)	1228
EcoO109I	RGGNCCY	1 cut(s)	1852
EcoRII	CCWGG	2 cut(s)	1387, 1630
EcoT14I	CCWWGG	2 cut(s)	489, 1251
EcoT22I	ATGCAT	2 cut(s)	912, 1281
EcoT38I	GRGCYC	1 cut(s)	1230
ErhI	CCWWGG	2 cut(s)	489, 1251
FalI	AAGNNNNNCTT	2 cut(s)	1028, 1060
FaqI	GGGAC	3 cut(s)	425, 578, 1838
FauI	CCCGC	2 cut(s)	649, 1864
FauNDI	CATATG	1 cut(s)	498
FbaI	TGATCA	1 cut(s)	1200
Fnu4HI	GCNGC	4 cut(s)	67, 511, 916, 1664
FokI	GGATG	2 cut(s)	986, 1387
FriOI	GRGCYC	1 cut(s)	1230
Fsp4HI	GCNGC	4 cut(s)	67, 511, 916, 1664
FspBI	CTAG	6 cut(s)	618, 1350, 1544, 1700, 1761, 1818
GlaI	GCGC	6 cut(s)	583, 720, 795, 1690, 1751, 1808
GluI	GCNGC	4 cut(s)	67, 511, 916, 1664
HaeIII	GGCC	7 cut(s)	141, 200, 395, 667, 915, 929, 1601
HapII	CCGG	6 cut(s)	233, 300, 402, 668, 971, 1017
HgaI	GACGC	1 cut(s)	118
HhaI	GCGC	6 cut(s)	584, 721, 796, 1691, 1752, 1809
Hin1I	GRCGYC	1 cut(s)	93
Hin6I	GCGC	6 cut(s)	582, 719, 794, 1689, 1750, 1807
HinP1I	GCGC	6 cut(s)	582, 719, 794, 1689, 1750, 1807
HindIII	AAGCTT	2 cut(s)	318, 1232
HinfI	GANTC	7 cut(s)	236, 566, 743, 766, 957, 1283, 1657
HpaII	CCGG	6 cut(s)	233, 300, 402, 668, 971, 1017
HphI	GGTGA	6 cut(s)	362, 364, 460, 476, 1235, 1240
Hpy166II	GTNNAC	3 cut(s)	533, 705, 1076
Hpy188I	TCNGA	9 cut(s)	102, 146, 190, 241, 297, 483, 771, 1158, 1534
Hpy188III	TCNNGA	1 cut(s)	1618
Hpy8I	GTNNAC	3 cut(s)	533, 705, 1076
Hpy99I	CGWCG	2 cut(s)	95, 98
HpyAV	CCTTC	2 cut(s)	229, 532
HpyCH4III	ACNGT	7 cut(s)	87, 277, 506, 1458, 1677, 1738, 1905
HpyCH4IV	ACGT	2 cut(s)	93, 1072
HpyF10VI	GCNNNNNNNGC	3 cut(s)	182, 1171, 1225
HpyF3I	CTNAG	6 cut(s)	157, 294, 1080, 1685, 1746, 1803
HpySE526I	ACGT	2 cut(s)	93, 1072
Hsp92I	GRCGYC	1 cut(s)	93
HspAI	GCGC	6 cut(s)	582, 719, 794, 1689, 1750, 1807
Ksp22I	TGATCA	1 cut(s)	1200
KspI	CCGCGG	1 cut(s)	919
Kzo9I	GATC	3 cut(s)	1083, 1200, 1383
LmnI	GCTCC	4 cut(s)	27, 579, 781, 1392
Lsp1109I	GCAGC	2 cut(s)	53, 497
LweI	GCATC	6 cut(s)	247, 613, 636, 1254, 1561, 1873
MaeI	CTAG	6 cut(s)	618, 1350, 1544, 1700, 1761, 1818
MaeII	ACGT	2 cut(s)	93, 1072
MalI	GATC	3 cut(s)	1085, 1202, 1385
MbiI	CCGCTC	3 cut(s)	1684, 1745, 1802
MboI	GATC	3 cut(s)	1083, 1200, 1383
MfeI	CAATTG	1 cut(s)	870
MflI	RGATCY	1 cut(s)	1383
MhlI	GDGCHC	3 cut(s)	535, 1230, 1397
MlsI	TGGCCA	1 cut(s)	1601
MluCI	AATT	8 cut(s)	134, 368, 418, 452, 870, 1064, 1419, 1427
MluNI	TGGCCA	1 cut(s)	1601
MlyI	GAGTC	4 cut(s)	560, 752, 966, 1292
MmeI	TCCRAC	3 cut(s)	106, 213, 1329
Mox20I	TGGCCA	1 cut(s)	1601
Mph1103I	ATGCAT	2 cut(s)	912, 1281
MroXI	GAANNNNTTC	1 cut(s)	542
MscI	TGGCCA	1 cut(s)	1601
MseI	TTAA	4 cut(s)	42, 345, 1259, 1577
MslI	CAYNNNNRTG	1 cut(s)	803
Msp20I	TGGCCA	1 cut(s)	1601
MspA1I	CMGCKG	2 cut(s)	918, 1874
MspI	CCGG	6 cut(s)	233, 300, 402, 668, 971, 1017
MspR9I	CCNGG	3 cut(s)	1018, 1389, 1632
MunI	CAATTG	1 cut(s)	870
MvaI	CCWGG	2 cut(s)	1389, 1632
MvnI	CGCG	2 cut(s)	584, 918
MwoI	GCNNNNNNNGC	3 cut(s)	182, 1171, 1225
NciI	CCSGG	1 cut(s)	1018
NcoI	CCATGG	1 cut(s)	489
NdeI	CATATG	1 cut(s)	498
NdeII	GATC	3 cut(s)	1083, 1200, 1383
NheI	GCTAGC	2 cut(s)	1760, 1817
NlaIV	GGNNCC	2 cut(s)	969, 1854
NmeAIII	GCCGAG	1 cut(s)	1145
NsiI	ATGCAT	2 cut(s)	912, 1281
NspI	RCATGY	2 cut(s)	808, 1133
PasI	CCCWGGG	1 cut(s)	1388
PceI	AGGCCT	1 cut(s)	395
PciI	ACATGT	2 cut(s)	804, 1129
PcsI	WCGNNNNNNNCGW	1 cut(s)	581
PdmI	GAANNNNTTC	1 cut(s)	542
PfeI	GAWTC	3 cut(s)	236, 766, 1657
PinAI	ACCGGT	1 cut(s)	299
PkrI	GCNGC	4 cut(s)	68, 512, 917, 1665
PleI	GAGTC	4 cut(s)	560, 751, 965, 1291
PpsI	GAGTC	4 cut(s)	560, 751, 965, 1291
PpuMI	RGGWCCY	1 cut(s)	1852
PscI	ACATGT	2 cut(s)	804, 1129
Psp124BI	GAGCTC	1 cut(s)	1230
Psp5II	RGGWCCY	1 cut(s)	1852
Psp6I	CCWGG	2 cut(s)	1387, 1630
PspGI	CCWGG	2 cut(s)	1387, 1630
PspN4I	GGNNCC	2 cut(s)	969, 1854
PspPI	GGNCC	2 cut(s)	139, 1852
PspPPI	RGGWCCY	1 cut(s)	1852
PsuI	RGATCY	1 cut(s)	1383
RsaI	GTAC	4 cut(s)	503, 706, 1043, 1077
RsaNI	GTAC	4 cut(s)	502, 705, 1042, 1076
RseI	CAYNNNNRTG	1 cut(s)	803
SacI	GAGCTC	1 cut(s)	1230
SacII	CCGCGG	1 cut(s)	919
SaqAI	TTAA	4 cut(s)	42, 345, 1259, 1577
SatI	GCNGC	4 cut(s)	67, 511, 916, 1664
Sau3AI	GATC	3 cut(s)	1083, 1200, 1383
Sau96I	GGNCC	2 cut(s)	139, 1852
SchI	GAGTC	4 cut(s)	560, 752, 966, 1292
ScrFI	CCNGG	3 cut(s)	1018, 1389, 1632
SduI	GDGCHC	3 cut(s)	535, 1230, 1397
SfaNI	GCATC	6 cut(s)	247, 613, 636, 1254, 1561, 1873
Sfr303I	CCGCGG	1 cut(s)	919
SgrBI	CCGCGG	1 cut(s)	919
SinI	GGWCC	1 cut(s)	1852
SmiMI	CAYNNNNRTG	1 cut(s)	803
SmlI	CTYRAG	4 cut(s)	194, 389, 722, 1229
SmoI	CTYRAG	4 cut(s)	194, 389, 722, 1229
Sse9I	AATT	8 cut(s)	134, 368, 418, 452, 870, 1064, 1419, 1427
SseBI	AGGCCT	1 cut(s)	395
SspI	AATATT	1 cut(s)	8
SspMI	CTAG	6 cut(s)	618, 1350, 1544, 1700, 1761, 1818
SstI	GAGCTC	1 cut(s)	1230
StuI	AGGCCT	1 cut(s)	395
StyD4I	CCNGG	3 cut(s)	1016, 1387, 1630
StyI	CCWWGG	2 cut(s)	489, 1251
TaaI	ACNGT	7 cut(s)	87, 277, 506, 1458, 1677, 1738, 1905
TaiI	ACGT	2 cut(s)	96, 1075
TaqI	TCGA	5 cut(s)	255, 546, 1026, 1086, 1286
TasI	AATT	8 cut(s)	134, 368, 418, 452, 870, 1064, 1419, 1427
TatI	WGTACW	1 cut(s)	501
TauI	GCSGC	2 cut(s)	918, 1666
TfiI	GAWTC	3 cut(s)	236, 766, 1657
Tru1I	TTAA	4 cut(s)	42, 345, 1259, 1577
Tru9I	TTAA	4 cut(s)	42, 345, 1259, 1577
TscAI	CASTG	1 cut(s)	1210
TseI	GCWGC	2 cut(s)	66, 510
TspGWI	ACGGA	1 cut(s)	550
TspRI	CASTG	1 cut(s)	1210
VneI	GTGCAC	1 cut(s)	531
VpaK11BI	GGWCC	1 cut(s)	1852
XapI	RAATTY	6 cut(s)	368, 418, 452, 1064, 1419, 1427
XceI	RCATGY	2 cut(s)	808, 1133
XmnI	GAANNNNTTC	1 cut(s)	542
XspI	CTAG	6 cut(s)	618, 1350, 1544, 1700, 1761, 1818
ZraI	GACGTC	1 cut(s)	94
Zsp2I	ATGCAT	2 cut(s)	912, 1281

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.