Rmu_sc0024699.1_g000001

DNA-3-methyladenine

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024699.1
Physical Location & Seq
Forward (+)
1 .. 1623
1623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024699.1_g000001.1.cds

Sequence Viewer

Length: 299 bp
gattggagaccatacagcaacgtcgagggcagaagactagtaagcctgttctccttagtggaccaggaaagatcggtcaagccctgggactttctacagaatggtctaaccaccccctctacactcctggtggtctggaaatcttagatggtcccccgcctgaaaacatgttgattggtccacgtgtaggcattaactatgctttgcctgagcacgtcaatgcgttgtggagatttgcaattgcaggtaccccttggataagtgctccgaagaacactctcaggccaccgtcatcttag

Protein Analysis

98

Amino Acids

10.57

Weight (kDa)

9.69

Isoelectric Point (pI)

41.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 235
Acc65I GGTACC 1 cut(s) 247
AccB1I GGYRCC 1 cut(s) 247
AciI CCGC 1 cut(s) 157
AcvI CACGTG 1 cut(s) 184
AfaI GTAC 1 cut(s) 249
AfiI CCNNNNNNNGG 1 cut(s) 187
AflIII ACRYGT 2 cut(s) 167, 183
AhlI ACTAGT 1 cut(s) 37
AjiI CACGTC 1 cut(s) 216
AjnI CCWGG 3 cut(s) 63, 83, 126
Alw21I GWGCWC 2 cut(s) 215, 267
AoxI GGCC 1 cut(s) 283
Asp718I GGTACC 1 cut(s) 247
AspS9I GGNCC 3 cut(s) 61, 151, 178
AvaII GGWCC 3 cut(s) 61, 151, 178
BanI GGYRCC 1 cut(s) 247
BbrPI CACGTG 1 cut(s) 184
BbsI GAAGAC 1 cut(s) 40
Bbv12I GWGCWC 2 cut(s) 215, 267
BccI CCATC 1 cut(s) 142
BciT130I CCWGG 3 cut(s) 65, 85, 128
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 95
BfuAI ACCTGC 1 cut(s) 235
Bme1390I CCNGG 3 cut(s) 65, 85, 128
Bme18I GGWCC 3 cut(s) 61, 151, 178
BmgBI CACGTC 1 cut(s) 216
BmgT120I GGNCC 3 cut(s) 61, 151, 178
BmiI GGNNCC 2 cut(s) 153, 249
BmrFI CCNGG 3 cut(s) 65, 85, 128
BpiI GAAGAC 1 cut(s) 40
Bpu10I CCTNAGC 1 cut(s) 209
BsaAI YACGTR 1 cut(s) 184
BsaJI CCNNGG 3 cut(s) 83, 84, 253
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 3 cut(s) 65, 85, 128
BseDI CCNNGG 3 cut(s) 83, 84, 253
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 2 cut(s) 200, 294
BshFI GGCC 1 cut(s) 285
BshNI GGYRCC 1 cut(s) 247
BsiHKAI GWGCWC 2 cut(s) 215, 267
BslFI GGGAC 2 cut(s) 101, 137
BslI CCNNNNNNNGG 1 cut(s) 187
BsmFI GGGAC 2 cut(s) 101, 137
BsnI GGCC 1 cut(s) 285
Bsp1286I GDGCHC 2 cut(s) 215, 267
Bsp143I GATC 1 cut(s) 71
BspACI CCGC 1 cut(s) 157
BspANI GGCC 1 cut(s) 285
BspCNI CTCAG 2 cut(s) 201, 293
BspLI GGNNCC 2 cut(s) 153, 249
BspMI ACCTGC 1 cut(s) 235
BspT107I GGYRCC 1 cut(s) 247
BssECI CCNNGG 3 cut(s) 83, 84, 253
BssMI GATC 1 cut(s) 71
BssT1I CCWWGG 1 cut(s) 253
Bst2UI CCWGG 3 cut(s) 65, 85, 128
Bst4CI ACNGT 1 cut(s) 290
BstBAI YACGTR 1 cut(s) 184
BstDEI CTNAG 5 cut(s) 55, 144, 209, 280, 296
BstKTI GATC 1 cut(s) 74
BstMBI GATC 1 cut(s) 71
BstNI CCWGG 3 cut(s) 65, 85, 128
BstNSI RCATGY 1 cut(s) 171
BstSCI CCNGG 3 cut(s) 63, 83, 126
BstSFI CTRYAG 1 cut(s) 95
BstV2I GAAGAC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 285
BtrI CACGTC 1 cut(s) 216
BveI ACCTGC 1 cut(s) 235
Cfr13I GGNCC 3 cut(s) 61, 151, 178
Csp6I GTAC 1 cut(s) 248
CviAII CATG 1 cut(s) 168
CviJI RGCY 3 cut(s) 45, 82, 285
CviKI_1 RGCY 3 cut(s) 45, 82, 285
CviQI GTAC 1 cut(s) 248
DdeI CTNAG 5 cut(s) 55, 144, 209, 280, 296
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
Eco130I CCWWGG 1 cut(s) 253
Eco47I GGWCC 3 cut(s) 61, 151, 178
Eco72I CACGTG 1 cut(s) 184
EcoRII CCWGG 3 cut(s) 63, 83, 126
EcoT14I CCWWGG 1 cut(s) 253
ErhI CCWWGG 1 cut(s) 253
FaeI CATG 1 cut(s) 171
FaiI YATR 3 cut(s) 13, 169, 200
FaqI GGGAC 2 cut(s) 101, 137
FatI CATG 1 cut(s) 167
FauI CCCGC 1 cut(s) 164
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 285
Hin1II CATG 1 cut(s) 171
Hpy166II GTNNAC 2 cut(s) 61, 181
Hpy188I TCNGA 1 cut(s) 269
Hpy188III TCNNGA 1 cut(s) 136
Hpy8I GTNNAC 2 cut(s) 61, 181
Hpy99I CGWCG 1 cut(s) 26
HpyCH4III ACNGT 1 cut(s) 290
HpyCH4IV ACGT 3 cut(s) 21, 183, 215
HpyCH4V TGCA 2 cut(s) 238, 244
HpyF3I CTNAG 5 cut(s) 55, 144, 209, 280, 296
HpySE526I ACGT 3 cut(s) 21, 183, 215
Hsp92II CATG 1 cut(s) 171
KpnI GGTACC 1 cut(s) 251
Kzo9I GATC 1 cut(s) 71
LmnI GCTCC 1 cut(s) 270
MaeI CTAG 1 cut(s) 38
MaeII ACGT 3 cut(s) 21, 183, 215
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 2 cut(s) 45, 282
MfeI CAATTG 1 cut(s) 239
MhlI GDGCHC 2 cut(s) 215, 267
MluCI AATT 1 cut(s) 239
MnlI CCTC 2 cut(s) 19, 127
MseI TTAA 1 cut(s) 194
MslI CAYNNNNRTG 1 cut(s) 218
MspR9I CCNGG 3 cut(s) 65, 85, 128
MunI CAATTG 1 cut(s) 239
MvaI CCWGG 3 cut(s) 65, 85, 128
NdeII GATC 1 cut(s) 71
NlaIII CATG 1 cut(s) 171
NlaIV GGNNCC 2 cut(s) 153, 249
NspI RCATGY 1 cut(s) 171
PasI CCCWGGG 1 cut(s) 84
PciI ACATGT 1 cut(s) 167
PmaCI CACGTG 1 cut(s) 184
PmlI CACGTG 1 cut(s) 184
Ppu21I YACGTR 1 cut(s) 184
PscI ACATGT 1 cut(s) 167
Psp6I CCWGG 3 cut(s) 63, 83, 126
PspCI CACGTG 1 cut(s) 184
PspGI CCWGG 3 cut(s) 63, 83, 126
PspN4I GGNNCC 2 cut(s) 153, 249
PspPI GGNCC 3 cut(s) 61, 151, 178
RsaI GTAC 1 cut(s) 249
RsaNI GTAC 1 cut(s) 248
RseI CAYNNNNRTG 1 cut(s) 218
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 3 cut(s) 61, 151, 178
ScrFI CCNGG 3 cut(s) 65, 85, 128
SduI GDGCHC 2 cut(s) 215, 267
SetI ASST 4 cut(s) 24, 186, 218, 249
SfcI CTRYAG 1 cut(s) 95
SinI GGWCC 3 cut(s) 61, 151, 178
SmiMI CAYNNNNRTG 1 cut(s) 218
SpeI ACTAGT 1 cut(s) 37
Sse9I AATT 1 cut(s) 239
SsiI CCGC 1 cut(s) 157
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 3 cut(s) 63, 83, 126
StyI CCWWGG 1 cut(s) 253
TaaI ACNGT 1 cut(s) 290
TaiI ACGT 3 cut(s) 24, 186, 218
TaqI TCGA 1 cut(s) 24
TaqII GACCGA 1 cut(s) 64
TasI AATT 1 cut(s) 239
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
VpaK11BI GGWCC 3 cut(s) 61, 151, 178
XceI RCATGY 1 cut(s) 171
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.