Rmu_sc0025482.1_g000002

UPF0690 protein C1orf52 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025482.1
Physical Location & Seq
Reverse (-)
2013 .. 2582
570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025482.1_g000002.1.cds

Sequence Viewer

Length: 489 bp
atgccatggagtgatgacgaggacgattcctcatccgacgaggagtccgaaccatcacaagtgaaatcagggaagccaaagagcaaggttttggatttcgaggcgttgaggaaacacggttacagaggaggaccgtctatactgaaggtgcctccgcccaaggagtccgatacggacaaggactggtcttggtcgaccggagtggatcacaaggtgaagagtggaaccaccaccaaggagaaggtggtggatgaagaagagagcaaagaacagcgacagaagacgagggatgcattggctgccggggagcagctggagtatgtgatgaccaggaaggagaaggagaaggagaaggagaagaacttgtcgttttcgcagaaggagaagaggaagagggaccttggccaggccagcagggggaagaactatgttgaagaagagaagaggttgctgagggagaatggtgtctactctgggtttgatgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

18.54

Weight (kDa)

5.89

Isoelectric Point (pI)

43.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015144)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 148
AccI GTMKAC 2 cut(s) 194, 468
AciI CCGC 1 cut(s) 155
AclWI GGATC 1 cut(s) 213
AcoI YGGCCR 1 cut(s) 403
AcuI CTGAAG 1 cut(s) 164
AdeI CACNNNGTG 1 cut(s) 214
AfiI CCNNNNNNNGG 2 cut(s) 406, 417
AgsI TTSAA 1 cut(s) 434
AhdI GACNNNNNGTC 1 cut(s) 43
AjnI CCWGG 2 cut(s) 329, 405
AluBI AGCT 1 cut(s) 313
AluI AGCT 1 cut(s) 313
AlwI GGATC 1 cut(s) 213
AoxI GGCC 2 cut(s) 403, 408
ApeKI GCWGC 2 cut(s) 299, 310
AspS9I GGNCC 2 cut(s) 131, 397
AsuC2I CCSGG 1 cut(s) 304
AsuHPI GGTGA 1 cut(s) 226
AvaII GGWCC 2 cut(s) 131, 397
BalI TGGCCA 1 cut(s) 405
BanI GGYRCC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 287
BbvCI CCTCAGC 1 cut(s) 452
BbvI GCAGC 2 cut(s) 286, 322
BccI CCATC 1 cut(s) 61
BciT130I CCWGG 2 cut(s) 331, 407
BcnI CCSGG 1 cut(s) 304
BisI GCNGC 2 cut(s) 300, 311
BlsI GCNGC 2 cut(s) 301, 312
Bme1390I CCNGG 3 cut(s) 304, 331, 407
Bme18I GGWCC 2 cut(s) 131, 397
BmeRI GACNNNNNGTC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 131, 397
BmiI GGNNCC 3 cut(s) 150, 226, 398
BmrFI CCNGG 3 cut(s) 304, 331, 407
BmsI GCATC 2 cut(s) 280, 472
BpiI GAAGAC 1 cut(s) 287
BpmI CTGGAG 1 cut(s) 335
Bpu10I CCTNAGC 1 cut(s) 452
BpuMI CCSGG 1 cut(s) 304
BsaJI CCNNGG 5 cut(s) 5, 159, 234, 303, 400
BsaWI WCCGGW 1 cut(s) 197
Bsc4I CCNNNNNNNGG 2 cut(s) 406, 417
Bse1I ACTGG 1 cut(s) 188
BseBI CCWGG 2 cut(s) 331, 407
BseDI CCNNGG 5 cut(s) 5, 159, 234, 303, 400
BseGI GGATG 3 cut(s) 32, 256, 295
BseLI CCNNNNNNNGG 2 cut(s) 406, 417
BseMII CTCAG 1 cut(s) 443
BseNI ACTGG 1 cut(s) 188
BseRI GAGGAG 2 cut(s) 56, 141
BseXI GCAGC 2 cut(s) 286, 322
Bsh1285I CGRYCG 1 cut(s) 198
BshFI GGCC 2 cut(s) 405, 410
BshNI GGYRCC 1 cut(s) 148
BsiEI CGRYCG 1 cut(s) 198
BsiSI CCGG 2 cut(s) 198, 303
BslFI GGGAC 1 cut(s) 410
BslI CCNNNNNNNGG 2 cut(s) 406, 417
BsmFI GGGAC 1 cut(s) 410
BsnI GGCC 2 cut(s) 405, 410
Bsp143I GATC 1 cut(s) 205
Bsp19I CCATGG 1 cut(s) 5
BspACI CCGC 1 cut(s) 155
BspANI GGCC 2 cut(s) 405, 410
BspCNI CTCAG 1 cut(s) 444
BspLI GGNNCC 3 cut(s) 150, 226, 398
BspPI GGATC 1 cut(s) 213
BspT107I GGYRCC 1 cut(s) 148
BsrI ACTGG 1 cut(s) 188
BssECI CCNNGG 5 cut(s) 5, 159, 234, 303, 400
BssMI GATC 1 cut(s) 205
BssT1I CCWWGG 4 cut(s) 5, 159, 234, 400
Bst2UI CCWGG 2 cut(s) 331, 407
Bst4CI ACNGT 2 cut(s) 119, 135
Bst6I CTCTTC 6 cut(s) 212, 252, 380, 386, 432, 437
BstAPI GCANNNNNTGC 1 cut(s) 299
BstC8I GCNNGC 1 cut(s) 412
BstDEI CTNAG 2 cut(s) 452, 486
BstDSI CCRYGG 1 cut(s) 5
BstENI CCTNNNNNAGG 1 cut(s) 404
BstF5I GGATG 3 cut(s) 32, 256, 295
BstKTI GATC 1 cut(s) 208
BstMBI GATC 1 cut(s) 205
BstMCI CGRYCG 1 cut(s) 198
BstMWI GCNNNNNNNGC 2 cut(s) 299, 411
BstNI CCWGG 2 cut(s) 331, 407
BstSCI CCNGG 3 cut(s) 302, 329, 405
BstV1I GCAGC 2 cut(s) 286, 322
BstV2I GAAGAC 1 cut(s) 287
BsuRI GGCC 2 cut(s) 405, 410
BtgI CCRYGG 1 cut(s) 5
BtsCI GGATG 3 cut(s) 32, 256, 295
Cac8I GCNNGC 1 cut(s) 412
Cfr13I GGNCC 2 cut(s) 131, 397
CviAII CATG 1 cut(s) 6
CviJI RGCY 5 cut(s) 76, 299, 313, 405, 410
CviKI_1 RGCY 5 cut(s) 76, 299, 313, 405, 410
DdeI CTNAG 2 cut(s) 452, 486
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
DraIII CACNNNGTG 1 cut(s) 214
DriI GACNNNNNGTC 1 cut(s) 43
EaeI YGGCCR 1 cut(s) 403
Eam1104I CTCTTC 6 cut(s) 212, 252, 380, 386, 432, 437
Eam1105I GACNNNNNGTC 1 cut(s) 43
EarI CTCTTC 6 cut(s) 212, 252, 380, 386, 432, 437
EciI GGCGGA 1 cut(s) 144
Eco130I CCWWGG 4 cut(s) 5, 159, 234, 400
Eco47I GGWCC 2 cut(s) 131, 397
Eco57I CTGAAG 1 cut(s) 164
EcoNI CCTNNNNNAGG 1 cut(s) 404
EcoO109I RGGNCCY 1 cut(s) 397
EcoRII CCWGG 2 cut(s) 329, 405
EcoT14I CCWWGG 4 cut(s) 5, 159, 234, 400
EcoT22I ATGCAT 1 cut(s) 295
ErhI CCWWGG 4 cut(s) 5, 159, 234, 400
FaeI CATG 1 cut(s) 9
FaiI YATR 4 cut(s) 7, 140, 321, 429
FaqI GGGAC 1 cut(s) 410
FatI CATG 1 cut(s) 5
FblI GTMKAC 2 cut(s) 194, 468
Fnu4HI GCNGC 2 cut(s) 300, 311
FokI GGATG 3 cut(s) 19, 263, 302
Fsp4HI GCNGC 2 cut(s) 300, 311
GluI GCNGC 2 cut(s) 300, 311
GsuI CTGGAG 1 cut(s) 335
HaeIII GGCC 2 cut(s) 405, 410
HapII CCGG 2 cut(s) 198, 303
Hin1II CATG 1 cut(s) 9
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 3 cut(s) 26, 44, 164
HpaII CCGG 2 cut(s) 198, 303
HphI GGTGA 1 cut(s) 226
Hpy166II GTNNAC 2 cut(s) 195, 469
Hpy188I TCNGA 3 cut(s) 37, 49, 169
Hpy8I GTNNAC 2 cut(s) 195, 469
Hpy99I CGWCG 1 cut(s) 41
HpyAV CCTTC 7 cut(s) 139, 235, 328, 334, 340, 346, 373
HpyCH4III ACNGT 2 cut(s) 119, 135
HpyCH4V TGCA 1 cut(s) 293
HpyF10VI GCNNNNNNNGC 2 cut(s) 299, 411
HpyF3I CTNAG 2 cut(s) 452, 486
Hsp92II CATG 1 cut(s) 9
Kzo9I GATC 1 cut(s) 205
LmnI GCTCC 1 cut(s) 307
Lsp1109I GCAGC 2 cut(s) 286, 322
LweI GCATC 2 cut(s) 280, 472
MaeIII GTNAC 1 cut(s) 119
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MlsI TGGCCA 1 cut(s) 405
MluNI TGGCCA 1 cut(s) 405
MlyI GAGTC 2 cut(s) 53, 173
MmeI TCCRAC 1 cut(s) 60
Mox20I TGGCCA 1 cut(s) 405
Mph1103I ATGCAT 1 cut(s) 295
MscI TGGCCA 1 cut(s) 405
Msp20I TGGCCA 1 cut(s) 405
MspA1I CMGCKG 1 cut(s) 313
MspI CCGG 2 cut(s) 198, 303
MspR9I CCNGG 3 cut(s) 304, 331, 407
MvaI CCWGG 2 cut(s) 331, 407
MwoI GCNNNNNNNGC 2 cut(s) 299, 411
NciI CCSGG 1 cut(s) 304
NcoI CCATGG 1 cut(s) 5
NdeII GATC 1 cut(s) 205
NlaIII CATG 1 cut(s) 9
NlaIV GGNNCC 3 cut(s) 150, 226, 398
NsiI ATGCAT 1 cut(s) 295
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PfeI GAWTC 1 cut(s) 26
PkrI GCNGC 2 cut(s) 301, 312
PleI GAGTC 2 cut(s) 52, 172
PpsI GAGTC 2 cut(s) 52, 172
PpuMI RGGWCCY 1 cut(s) 397
Psp5II RGGWCCY 1 cut(s) 397
Psp6I CCWGG 2 cut(s) 329, 405
PspGI CCWGG 2 cut(s) 329, 405
PspN4I GGNNCC 3 cut(s) 150, 226, 398
PspPI GGNCC 2 cut(s) 131, 397
PspPPI RGGWCCY 1 cut(s) 397
PvuII CAGCTG 1 cut(s) 313
SalI GTCGAC 1 cut(s) 193
SatI GCNGC 2 cut(s) 300, 311
Sau3AI GATC 1 cut(s) 205
Sau96I GGNCC 2 cut(s) 131, 397
SchI GAGTC 2 cut(s) 53, 173
ScrFI CCNGG 3 cut(s) 304, 331, 407
SetI ASST 7 cut(s) 90, 150, 216, 246, 315, 402, 449
SfaNI GCATC 2 cut(s) 280, 472
SinI GGWCC 2 cut(s) 131, 397
SsiI CCGC 1 cut(s) 155
StyD4I CCNGG 3 cut(s) 302, 329, 405
StyI CCWWGG 4 cut(s) 5, 159, 234, 400
TaaI ACNGT 2 cut(s) 119, 135
TaqI TCGA 2 cut(s) 99, 194
TfiI GAWTC 1 cut(s) 26
TseI GCWGC 2 cut(s) 299, 310
TspDTI ATGAA 1 cut(s) 267
TspGWI ACGGA 1 cut(s) 188
VpaK11BI GGWCC 2 cut(s) 131, 397
XagI CCTNNNNNAGG 1 cut(s) 404
XcmI CCANNNNNNNNNTGG 1 cut(s) 241
XmiI GTMKAC 2 cut(s) 194, 468
Zsp2I ATGCAT 1 cut(s) 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.