Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026887.1

Orthogroup ID

OG0007495

Physical Location & Seq

Genomic Coordinates Forward (+)

1194 .. 1980

Gene Structure 787 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026887.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 787 bp

atggcctctattcaagcttctttttgttctgctacattttcttcagcttcctctagaaaaatcaaagctactctccactcccaaaacattgaatcatcccgtctttcagttcccaggctcctggttaatgaactgaatcaaagaaatgggtcactcaacctaacagccacttcatctgaaatagaagtgaaaccattatttgacaacagaaaaaggtcaaatctcggtgactcagtttcagattcaaactttgtccaagagctctatgcaatcatggaaattgtggcagatagaatagaaatgcacaacaacataaaggctcagagggacaactggaatggtctgcttctcaactctgtgaatgggatgacagccacagctgcaatcatggcgggacttgcatgtgtctctggatctggaccgtccattttgtctctcaagatctcatcaagtctcctatacatggctgtgactgggattgttctagtgatgaacaagatccaaccttcacagctagcagaggaacaaagaaatgcttcaaggctgttcaagaagcttcatgaagaaatcaaaaccactttggctctcaaaaacccagttacttcttacgatgtgaaagtcacaatggaaaaggttttggctttggataaggcatacccacttcccttacttggaaccatgattgagaagtttcctcaaattgtggagccagctgtgtggtggcctgaggaagaacccaagtgccatgatcataacatgagtgacaagtttgagaggaatgggtgga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Chloroplast_duf

Protein Analysis

262

Amino Acids

29.07

Weight (kDa)

7.72

Isoelectric Point (pI)

57.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007495)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23080
malus_domestica	MD11G1214100.v1.1
prunus_persica	Prupe.4G217100_v2.0.a1
pyrus_communis	pycom11g18860
rosa_chinensis	RchiOBHm_Chr5g0040591 RchiOBHm_Chr5g0040661
rosa_laevigata	RLG00000033990 RLG00000033992
rosa_multiflora	Rmu_co8282641.1_g000001 Rmu_co8333007.1_g000001 Rmu_sc0003916.1_g000011 Rmu_sc0026887.1_g000001
rosa_roxburghii	Rroxscaffold_1G00040020 Rroxscaffold_1G00040050 Rroxscaffold_1G00040080 Rroxscaffold_1G00040790
rosa_rugosa	Rorug05G0185900 Rorug05G0186100
rosa_samantha	Rh5BG276900 Rh5BG277500 Rh5CG308400 Rh5CG308600 Rh5DG285500
rosa_wichuraiana	Rw5G025530 Rw5G025560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	392
AclWI	GGATC	2 cut(s)	421, 493
AcuI	CTGAAG	1 cut(s)	27
AfiI	CCNNNNNNNGG	2 cut(s)	463, 671
AgsI	TTSAA	5 cut(s)	14, 92, 246, 540, 550
AjnI	CCWGG	2 cut(s)	113, 120
AluBI	AGCT	8 cut(s)	17, 47, 68, 262, 380, 514, 556, 713
AluI	AGCT	8 cut(s)	17, 47, 68, 262, 380, 514, 556, 713
Alw21I	GWGCWC	1 cut(s)	264
Alw26I	GTCTC	3 cut(s)	412, 438, 458
AlwI	GGATC	2 cut(s)	421, 493
AoxI	GGCC	2 cut(s)	3, 722
ApeKI	GCWGC	1 cut(s)	380
Asp700I	GAANNNNTTC	1 cut(s)	535
AspS9I	GGNCC	1 cut(s)	419
AsuHPI	GGTGA	1 cut(s)	239
AsuNHI	GCTAGC	1 cut(s)	514
AvaII	GGWCC	1 cut(s)	419
AxyI	CCTNAGG	1 cut(s)	726
BanII	GRGCYC	1 cut(s)	264
Bbv12I	GWGCWC	1 cut(s)	264
BbvI	GCAGC	1 cut(s)	367
BciT130I	CCWGG	2 cut(s)	115, 122
BclI	TGATCA	1 cut(s)	748
BcoDI	GTCTC	3 cut(s)	412, 438, 458
BfaI	CTAG	3 cut(s)	54, 485, 515
BglII	AGATCT	1 cut(s)	441
BisI	GCNGC	1 cut(s)	381
BlsI	GCNGC	1 cut(s)	382
Bme1390I	CCNGG	2 cut(s)	115, 122
Bme18I	GGWCC	1 cut(s)	419
BmgT120I	GGNCC	1 cut(s)	419
BmiI	GGNNCC	3 cut(s)	119, 676, 708
BmrFI	CCNGG	2 cut(s)	115, 122
BmrI	ACTGGG	2 cut(s)	483, 590
BmtI	GCTAGC	1 cut(s)	518
BmuI	ACTGGG	2 cut(s)	483, 590
BpuEI	CTTGAG	1 cut(s)	422
BsaJI	CCNNGG	1 cut(s)	113
Bsc4I	CCNNNNNNNGG	2 cut(s)	463, 671
Bse1I	ACTGG	3 cut(s)	338, 478, 596
Bse21I	CCTNAGG	1 cut(s)	726
BseBI	CCWGG	2 cut(s)	115, 122
BseDI	CCNNGG	1 cut(s)	113
BseGI	GGATG	2 cut(s)	95, 372
BseLI	CCNNNNNNNGG	2 cut(s)	463, 671
BseMII	CTCAG	3 cut(s)	246, 335, 717
BseNI	ACTGG	3 cut(s)	338, 478, 596
BseXI	GCAGC	1 cut(s)	367
BshFI	GGCC	2 cut(s)	5, 724
BsiHKAI	GWGCWC	1 cut(s)	264
BslFI	GGGAC	2 cut(s)	341, 408
BslI	CCNNNNNNNGG	2 cut(s)	463, 671
BsmAI	GTCTC	3 cut(s)	412, 438, 458
BsmFI	GGGAC	2 cut(s)	341, 408
BsnI	GGCC	2 cut(s)	5, 724
Bsp1286I	GDGCHC	1 cut(s)	264
Bsp143I	GATC	4 cut(s)	413, 441, 498, 748
BspACI	CCGC	1 cut(s)	392
BspANI	GGCC	2 cut(s)	5, 724
BspCNI	CTCAG	3 cut(s)	245, 334, 718
BspHI	TCATGA	1 cut(s)	559
BspLI	GGNNCC	3 cut(s)	119, 676, 708
BspOI	GCTAGC	1 cut(s)	518
BspPI	GGATC	2 cut(s)	421, 493
BsrI	ACTGG	3 cut(s)	338, 478, 596
BssECI	CCNNGG	1 cut(s)	113
BssMI	GATC	4 cut(s)	413, 441, 498, 748
Bst2UI	CCWGG	2 cut(s)	115, 122
Bst4CI	ACNGT	1 cut(s)	423
BstC8I	GCNNGC	2 cut(s)	516, 711
BstDEI	CTNAG	3 cut(s)	232, 321, 726
BstF5I	GGATG	2 cut(s)	95, 372
BstKTI	GATC	4 cut(s)	416, 444, 501, 751
BstMAI	GTCTC	3 cut(s)	412, 438, 458
BstMBI	GATC	4 cut(s)	413, 441, 498, 748
BstMWI	GCNNNNNNNGC	3 cut(s)	380, 389, 398
BstNI	CCWGG	2 cut(s)	115, 122
BstNSI	RCATGY	1 cut(s)	405
BstSCI	CCNGG	2 cut(s)	113, 120
BstV1I	GCAGC	1 cut(s)	367
BstX2I	RGATCY	3 cut(s)	413, 441, 498
BstXI	CCANNNNNNTGG	2 cut(s)	121, 717
BstYI	RGATCY	3 cut(s)	413, 441, 498
Bsu36I	CCTNAGG	1 cut(s)	726
BsuRI	GGCC	2 cut(s)	5, 724
BtsCI	GGATG	2 cut(s)	95, 372
Cac8I	GCNNGC	2 cut(s)	516, 711
CciI	TCATGA	1 cut(s)	559
Cfr13I	GGNCC	1 cut(s)	419
CviAII	CATG	8 cut(s)	274, 388, 402, 463, 560, 679, 746, 757
DdeI	CTNAG	3 cut(s)	232, 321, 726
DpnI	GATC	4 cut(s)	415, 443, 500, 750
DpnII	GATC	4 cut(s)	413, 441, 498, 748
Ecl136II	GAGCTC	1 cut(s)	262
Eco24I	GRGCYC	1 cut(s)	264
Eco47I	GGWCC	1 cut(s)	419
Eco53kI	GAGCTC	1 cut(s)	262
Eco57I	CTGAAG	1 cut(s)	27
Eco81I	CCTNAGG	1 cut(s)	726
EcoICRI	GAGCTC	1 cut(s)	262
EcoRII	CCWGG	2 cut(s)	113, 120
EcoT38I	GRGCYC	1 cut(s)	264
FaeI	CATG	8 cut(s)	277, 391, 405, 466, 563, 682, 749, 760
FalI	AAGNNNNNCTT	2 cut(s)	520, 552
FaqI	GGGAC	2 cut(s)	341, 408
FatI	CATG	8 cut(s)	273, 387, 401, 462, 559, 678, 745, 756
FauI	CCCGC	1 cut(s)	385
FbaI	TGATCA	1 cut(s)	748
Fnu4HI	GCNGC	1 cut(s)	381
FokI	GGATG	2 cut(s)	82, 379
FriOI	GRGCYC	1 cut(s)	264
Fsp4HI	GCNGC	1 cut(s)	381
FspBI	CTAG	3 cut(s)	54, 485, 515
GluI	GCNGC	1 cut(s)	381
HaeIII	GGCC	2 cut(s)	5, 724
Hin1II	CATG	8 cut(s)	277, 391, 405, 466, 563, 682, 749, 760
HindIII	AAGCTT	2 cut(s)	15, 554
HinfI	GANTC	4 cut(s)	92, 136, 230, 242
HphI	GGTGA	1 cut(s)	239
Hpy188I	TCNGA	3 cut(s)	178, 241, 324
Hpy188III	TCNNGA	6 cut(s)	54, 411, 417, 439, 550, 560
HpyAV	CCTTC	1 cut(s)	516
HpyCH4III	ACNGT	1 cut(s)	423
HpyCH4V	TGCA	4 cut(s)	269, 304, 383, 401
HpyF10VI	GCNNNNNNNGC	3 cut(s)	380, 389, 398
HpyF3I	CTNAG	3 cut(s)	232, 321, 726
Hsp92II	CATG	8 cut(s)	277, 391, 405, 466, 563, 682, 749, 760
Ksp22I	TGATCA	1 cut(s)	748
Kzo9I	GATC	4 cut(s)	413, 441, 498, 748
LmnI	GCTCC	2 cut(s)	123, 706
Lsp1109I	GCAGC	1 cut(s)	367
MaeI	CTAG	3 cut(s)	54, 485, 515
MaeIII	GTNAC	6 cut(s)	150, 227, 469, 598, 619, 761
MalI	GATC	4 cut(s)	415, 443, 500, 750
MboI	GATC	4 cut(s)	413, 441, 498, 748
MboII	GAAGA	3 cut(s)	33, 575, 743
MflI	RGATCY	3 cut(s)	413, 441, 498
MhlI	GDGCHC	1 cut(s)	264
MluCI	AATT	2 cut(s)	279, 699
MlyI	GAGTC	1 cut(s)	224
MmeI	TCCRAC	1 cut(s)	526
MnlI	CCTC	7 cut(s)	16, 61, 318, 514, 705, 721, 768
MroXI	GAANNNNTTC	1 cut(s)	535
MseI	TTAA	1 cut(s)	126
MslI	CAYNNNNRTG	1 cut(s)	467
MspA1I	CMGCKG	2 cut(s)	380, 713
MspR9I	CCNGG	2 cut(s)	115, 122
MvaI	CCWGG	2 cut(s)	115, 122
MwoI	GCNNNNNNNGC	3 cut(s)	380, 389, 398
NdeII	GATC	4 cut(s)	413, 441, 498, 748
NheI	GCTAGC	1 cut(s)	514
NlaIII	CATG	8 cut(s)	277, 391, 405, 466, 563, 682, 749, 760
NlaIV	GGNNCC	3 cut(s)	119, 676, 708
NmuCI	GTSAC	5 cut(s)	150, 227, 469, 619, 761
NspI	RCATGY	1 cut(s)	405
PagI	TCATGA	1 cut(s)	559
PdmI	GAANNNNTTC	1 cut(s)	535
PfeI	GAWTC	3 cut(s)	92, 136, 242
PkrI	GCNGC	1 cut(s)	382
PleI	GAGTC	1 cut(s)	224
PpsI	GAGTC	1 cut(s)	224
Psp124BI	GAGCTC	1 cut(s)	264
Psp6I	CCWGG	2 cut(s)	113, 120
PspGI	CCWGG	2 cut(s)	113, 120
PspN4I	GGNNCC	3 cut(s)	119, 676, 708
PspPI	GGNCC	1 cut(s)	419
PsuI	RGATCY	3 cut(s)	413, 441, 498
PvuII	CAGCTG	2 cut(s)	380, 713
RseI	CAYNNNNRTG	1 cut(s)	467
SacI	GAGCTC	1 cut(s)	264
SaqAI	TTAA	1 cut(s)	126
SatI	GCNGC	1 cut(s)	381
Sau3AI	GATC	4 cut(s)	413, 441, 498, 748
Sau96I	GGNCC	1 cut(s)	419
SchI	GAGTC	1 cut(s)	224
ScrFI	CCNGG	2 cut(s)	115, 122
SduI	GDGCHC	1 cut(s)	264
SinI	GGWCC	1 cut(s)	419
SmiMI	CAYNNNNRTG	1 cut(s)	467
SmlI	CTYRAG	1 cut(s)	437
SmoI	CTYRAG	1 cut(s)	437
Sse9I	AATT	2 cut(s)	279, 699
SsiI	CCGC	1 cut(s)	392
SspMI	CTAG	3 cut(s)	54, 485, 515
SstI	GAGCTC	1 cut(s)	264
StyD4I	CCNGG	2 cut(s)	113, 120
TaaI	ACNGT	1 cut(s)	423
TasI	AATT	2 cut(s)	279, 699
TfiI	GAWTC	3 cut(s)	92, 136, 242
Tru1I	TTAA	1 cut(s)	126
Tru9I	TTAA	1 cut(s)	126
TseFI	GTSAC	5 cut(s)	150, 227, 469, 619, 761
TseI	GCWGC	1 cut(s)	380
Tsp45I	GTSAC	5 cut(s)	150, 227, 469, 619, 761
TspDTI	ATGAA	5 cut(s)	144, 162, 506, 548, 576
VpaK11BI	GGWCC	1 cut(s)	419
XbaI	TCTAGA	1 cut(s)	53
XceI	RCATGY	1 cut(s)	405
XcmI	CCANNNNNNNNNTGG	1 cut(s)	717
XmnI	GAANNNNTTC	1 cut(s)	535
XspI	CTAG	3 cut(s)	54, 485, 515

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.