Rmu_sc0028327.1_g000001

Enoyl-(Acyl carrier protein) reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028327.1
OG0006083
Physical Location & Seq
Reverse (-)
2 .. 1216
1215 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028327.1_g000001.1.cds

Sequence Viewer

Length: 379 bp
atggggagtcctgctgcaaagaaagtcctgctcacctgcaatggggatgaaatttcatccaacatagccttacaattggcccaacgcggttgcaggttggttttgatgggcaaagagagctctttgaggagtgttgcagagaaaataaggggatcactggaaggtgtggtgtctatagaggtggttggtgtgggcatggaggaggagagagaaggagtttttgatgaggctgtggataaggcttgtgaaatcttgggtaatttggatgcctttgtgcattgctatgcctatgaaggagggatgcaagagcatttgcaattatctgaagatgagtttaagaaaataatgaagataaatttcatgtctgcttggtttctgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
adh_short_C2

Protein Analysis

126

Amino Acids

13.85

Weight (kDa)

4.83

Isoelectric Point (pI)

47.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 44
Acc36I ACCTGC 2 cut(s) 44, 84
AccII CGCG 1 cut(s) 87
AciI CCGC 1 cut(s) 87
AclWI GGATC 1 cut(s) 160
AcsI RAATTY 2 cut(s) 51, 355
AcuI CTGAAG 1 cut(s) 345
AfiI CCNNNNNNNGG 1 cut(s) 42
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
Alw21I GWGCWC 1 cut(s) 122
AlwI GGATC 1 cut(s) 160
AoxI GGCC 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 2 cut(s) 51, 355
AspS9I GGNCC 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 25
BanII GRGCYC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 122
BccI CCATC 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 174
BfuAI ACCTGC 2 cut(s) 44, 84
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 79
BmsI GCATC 2 cut(s) 256, 291
Bsc4I CCNNNNNNNGG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 162
Bse3DI GCAATG 2 cut(s) 46, 277
BseGI GGATG 4 cut(s) 52, 56, 271, 306
BseLI CCNNNNNNNGG 1 cut(s) 42
BseMI GCAATG 2 cut(s) 46, 277
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 3 cut(s) 142, 215, 218
Bsh1236I CGCG 1 cut(s) 87
BshFI GGCC 1 cut(s) 80
BsiHKAI GWGCWC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 42
BsnI GGCC 1 cut(s) 80
Bsp1286I GDGCHC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 152
BspACI CCGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 80
BspFNI CGCG 1 cut(s) 87
BspMI ACCTGC 2 cut(s) 44, 84
BspPI GGATC 1 cut(s) 160
BsrDI GCAATG 2 cut(s) 46, 277
BsrI ACTGG 1 cut(s) 162
BssMI GATC 1 cut(s) 152
BstF5I GGATG 4 cut(s) 52, 56, 271, 306
BstFNI CGCG 1 cut(s) 87
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 174
BstUI CGCG 1 cut(s) 87
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 4 cut(s) 52, 56, 271, 306
BtsIMutI CAGTG 1 cut(s) 155
BveI ACCTGC 2 cut(s) 44, 84
Cfr13I GGNCC 1 cut(s) 79
CviAII CATG 2 cut(s) 196, 361
CviJI RGCY 5 cut(s) 68, 80, 120, 230, 242
CviKI_1 RGCY 5 cut(s) 68, 80, 120, 230, 242
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Ecl136II GAGCTC 1 cut(s) 120
Eco24I GRGCYC 1 cut(s) 122
Eco53kI GAGCTC 1 cut(s) 120
Eco57I CTGAAG 1 cut(s) 345
EcoICRI GAGCTC 1 cut(s) 120
EcoT38I GRGCYC 1 cut(s) 122
FaeI CATG 2 cut(s) 199, 364
FaiI YATR 6 cut(s) 65, 176, 197, 285, 291, 362
FatI CATG 2 cut(s) 195, 360
Fnu4HI GCNGC 1 cut(s) 15
FokI GGATG 4 cut(s) 43, 59, 278, 313
FriOI GRGCYC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 1 cut(s) 80
Hin1II CATG 2 cut(s) 199, 364
HinfI GANTC 1 cut(s) 7
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 325
HpyAV CCTTC 3 cut(s) 155, 206, 287
HpyCH4V TGCA 7 cut(s) 17, 39, 93, 137, 277, 304, 316
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
Hsp92II CATG 2 cut(s) 199, 364
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 6 cut(s) 24, 41, 49, 79, 143, 362
LweI GCATC 2 cut(s) 256, 291
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 2 cut(s) 338, 361
MfeI CAATTG 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 5 cut(s) 51, 74, 259, 317, 355
MlyI GAGTC 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 6 cut(s) 120, 172, 193, 196, 220, 290
MseI TTAA 1 cut(s) 336
MslI CAYNNNNRTG 1 cut(s) 282
MunI CAATTG 1 cut(s) 74
MvnI CGCG 1 cut(s) 87
MwoI GCNNNNNNNGC 1 cut(s) 117
NdeII GATC 1 cut(s) 152
NlaIII CATG 2 cut(s) 199, 364
PaqCI CACCTGC 1 cut(s) 44
PkrI GCNGC 1 cut(s) 16
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
Psp124BI GAGCTC 1 cut(s) 122
PspPI GGNCC 1 cut(s) 79
RseI CAYNNNNRTG 1 cut(s) 282
SacI GAGCTC 1 cut(s) 122
SaqAI TTAA 1 cut(s) 336
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 1 cut(s) 152
Sau96I GGNCC 1 cut(s) 79
SchI GAGTC 1 cut(s) 16
SduI GDGCHC 1 cut(s) 122
SetI ASST 5 cut(s) 38, 98, 122, 166, 183
SfaNI GCATC 2 cut(s) 256, 291
SfcI CTRYAG 1 cut(s) 174
SmiMI CAYNNNNRTG 1 cut(s) 282
Sse9I AATT 5 cut(s) 51, 74, 259, 317, 355
SsiI CCGC 1 cut(s) 87
SstI GAGCTC 1 cut(s) 122
TasI AATT 5 cut(s) 51, 74, 259, 317, 355
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TscAI CASTG 1 cut(s) 162
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 5 cut(s) 45, 63, 306, 349, 362
TspRI CASTG 1 cut(s) 162
XapI RAATTY 2 cut(s) 51, 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.